Hordeum_vulgare Locus HORVU2Hr1G078550
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU2Hr1G078550
Hordeum_vulgare
HORVU2Hr1G078550
chr2H
snoZ152, SNORD14
2099..2193, 2686..2807
4857
TAGAGTGGTTTGGCCGCGTGGTTGCTTGGTTGGTTCGCTGGTGTATGTGATGACGAAAG
GGAAATGATGATATGCGCTAGTTACGAGTTGTGGCTCGCATGAAATGAAGTACGGGATGG
GAAGAGAATTGCCCCTCCACATGATATATTGACCTGTGTGGTCATGAACATGGAAAAATG
GAAGACTGTCCATGCTATTCCTCCTAAGGCACCGGTGCAGAAAGTGACACAAAAATGGGA
ACCTCCTGATGAGGGGTGGCGCAAGGTGAATTCGGATGAGGCAGACGCTCGACATGGCGA
ACAGGGCGACGGCGGTGCTATGATTAGGGATCACAATGTTGCGTTTCAGGGTGCAATGTG
CCATCTATTCCAAAACAACGAGGATGCGGAAGTGGTGGAAATCCCAGCCTGCAAACGTGC
ACTGGAGGTAGCAACACAGGTTGAGGCACACATGATGCACTTGGAGCTGGACTCCCAAGG
GGTGGTGCAGATGTTGAATCAAGCTCACAGGAACTTGTGTGCTTCTCGAAATCAAAGGCA
CTACTTCGGTCTTTTGCCGAGTTCAAAGTTTGTTGGGTTCGTCGGTTGACTAACGACGTC
GCGCATAAGTTAGCTAAGGTAGGGGTTAGTCATGAACTATGTAAGGTTTGGTTGTAGGAT
CCCCCGGACTTTGTCCTAGATGTAATTTCGGATGAGATTCTAACGTTTGAATTTTAAATA
AAGCAACGACCTTAGCCTAAAAAAAAATGCTTCACAAACACCCACGCTGTTGTGGGCCTG
ACCAGCATACTGTGGTTTCAGGTCCTTGTGCGGGGCCGAACTGCTGTGATTCAAGCCCAA
AAGGCCGCAGCCCGCAGGGCAGCGTATCGTTTTCTCTCGAACGAGCGAAGCACAGGGGTA
ATTATGCCAATTCACGATGGCTAGGGCAGCCCCCACTCGTTGCCACCCCCTATATAAGCG
CACCCAGCATCATCCAAAGCCTCATCTATCCTCCGCCGCCAGTTGAGTTCTCCATCTTTT
GCCTTCCGTTTATTATCTTTGTTGATTTGTTGGCGACTCTGCTTCGCGATTTCTTTTCTC
CACGGAGCATCTTGATCGGGGCATGTGACGATGATGATCTTTTCAACTTACCATCAAACT
CTGAATCGGTACTATGTCGATTACACCAAGTTTTCGTGAGTCTAATGCTATCTCATGTAT
TCGTTTTGTTGGCAGCTTTGCTTCGCTATTTCTCTTCTCCACTGAGCATCTTGATTGGGG
CGTTAGACGATGATGATCTTTTCAACTTACCATCAAACTCTGAATCGATACTATGTCGAT
TACACCAAGTTTTCGTGAGTCTAATGCGTTCTCATGTATTCGTTTTGTTGTCCTTTTTTT
GGTTTCTAGATTCGATTTACATCCTTTGAAGGCAATAAATTAGAGTCTCTGGTGCGCTTC
TTAATAGCGTAATTCAGCGCTGTACGTTGCCAATATGAATCTTTGGGCTAAGATTCTGGC
ACAGACCATTCTTCGAGATGGTTTGTGCATTCAACTTGTCCATACATATCTTCTATGTTT
TCGAGATTTGTTTGTGTCTTTTTTTGGTGATTTTGTTCATAGTCTTTTGATATTTTTATC
TGGTATTTCAGACTTCTTTACCCAAATCAGGAAAAATAACAGGACAATTTACTGAAATGA
GATGCTTATATATGCCAATTTAAGTGCAATGTAAGCATACTTGGTTAAACAATTCCAATG
CAATGAGATTGGATTAATTTCAAGGGATGATAGTTTCACAGTAAAACCCCAACCCTGTCT
ATACTTTCACTTCGATCTGATAGATCCATCGCACGAAATGGGTGGTATGAGATTTGTGTT
TGGCTAAGCTAGCCCTTTGCAGAGAAACCTGATGCAGTGATCTATGTGAATGTTTGTTTT
TGCAAGATCAGCTTCTTGTCTGGATGTTGTAACTTGCCATTCCAGCCAATCGGCAAATCG
TCCTGCCATCTTGCTAGATTGAAAACACAGTCGGCTTTCAACTCACCTGGATCTGATTAC
TCAATGATTTTCCGGGCCCTTTCCGTCGGCATATGACCTAATAGTTTTTATCTTGTTATG
ATGCGATGATGATCCATATAGGTTTTTGGCAGTGGTGGCTACTGTCACCGTGAGCCTTCA
AACCAAAAACGACTTCTCTTTCCACTGAGCATAACATTGTTCCAACCAATTCCGTCTTTT
ATAGGTTTCTCATTTCTGCAATGCCAGCATCTTGTCTCGGTGAAGAGCTCTAGACCAGGA
AGTGCCGTATGACACTGTAAACAGCAGCTGCTTCTATGTTTCTGCAAGTGTCCATCCCTG
TATCATAACCTTTGTGGTTTGCTCTGGGATGGAAATACCCATTTGCACCAGCTTGATTCA
GCTGTGTGCGTGATTTTAAACGGGTCTCTGAGAGATTTCTGAAATGCTTTATAGTTTATT
TTCTTTGGCCCGATGCCACGTCTCCAGTAGCCACAAGCCTTGATCGGAGATGCTACATTG
TGCCAACAGTGAGTTTTTGGACGTCTCACATTTGATAGGAACCTGTGGCTGTGATTCTGT
CGGTGCACAGAGCCGTTTTTTGTGACTACACTTTAATTGGCATACTTAAATCGTGACACC
TCGGTATTTGTTGTAGGTTTATTTCATTGAAAATAGGTGAAATGGATGGCTGTGATGATA
GAACTAAGGCTTGTTTCTCAAAACATTCGCAGATGCCGCCTAAGAGCTTTCGCCCTGCCA
GGCTTGAGAGCTTATGCTGCTAATTCCTTCCTTGGATGTCTGAGCCATGCTTATTTCCTC
ACCTTTTAGTTAACCAATCGTTGCAAAAAAAACCAATGTGCTTAGACTGTTTTTGATGCA
AGTAGACTTGCTGAAGATTCATCAGAGCTGGATGTGATCATGCTGTTGAGGTAGATACTC
ATGACGTTGTTTCTCAGAACATTTGAGCTGCTCCTGCTAATTGCTTGATTTCTTTGAACC
ATGCCAAGTTGTTTTTTTTAGATGAACAGGGAGGCAACCTTTCATTGGAAAACGAAACCA
GCATGAGTACAAACAGCCTAAATCTGTCTAAGGATATTTAAGACTGAAAAAGTAAAAGCG
CAGGCAAGCAAAAGGATCACAGAGCAATAGTTCATCCCTAGATGCATGGGTGCAAGACCT
CCTAGAATAGTTGGCTTGTGAACTCCAGCTTGAAGACGCATCGTCAGAGGAATTGAAAAT
CAGACTGATGCTTGAAGATGGAATCACCAGAGAGGATTCCACTACAAGTCCGCCACAATC
CAGGTGCAGAAATAGCTAAAGGCAATGCAAGCCTGATCCTCTCAAGAACGAGGCTAGAAG
GGGAAACTGACCGACCATGGGGCACCACGGGCGAGTAGAAGGCGACCCAACAGCCTCATC
TTGCGAAGGATTATGCAGGTCCAGGCACCTTTGGCACGCTTTGTCCGGGCGAGTCAGCCA
CCGGCGCCGACAGTTCCTATAAAGCAGGGATTAACCCATAATTATTTGTAACACTCCTAA
TCTTGGCTTATTTTATGAGCATCATCTTCATAGAAACTTCTCCAAAAACGTGGGAAAGAT
ATGATAAGAAAGTTGTTTGATATGTGACGGCTTTGAAATCATAAAAGTTTCTAATGAGGT
ATCAACATGACATATTTTCTATTTTTACCCTTTGGGCTTTTTAGACAAGTATATACATCA
TTTTCTTCTTATTTCCCCCATCAAATTCCATATTTTTGAAATGTAAAAGTTGTTACCTCA
CGTTATTGTGCATATAGCAATTTGCTTATTGCATAATCTATTTTCATCTAGGTTACACAA
GAAAGATGTAGATCTTGGCAACACTAAGTAGAAACACTAAGCTTGTCTATGATTTGACAT
AGCGGAGATCTCATCAATGTATCCAGATTTGTCCGTAATGAATTTCTAACTTGAAAAACA
TCAATGTATCCAGATTTGTCCGTAATGAATTTCTAACTTGAAAAACGATACTCCCTTCGT
CTTGGTGCATTAGATATCTTATGAAAATCAAATAATCCCAAAATGATAAGGCACATTACA
TGCATATTAATTAGACCTCATCTATTAATTCAAGGACCAATGCATGCAATTTATGCGACA
TGTTTTTTGGATTTAAAGAGGTCTTCTAATTCATAGCATGTTTTTAGTTTAGAAAGGAAT
AGTGTGATTGGCTTCCTCTACAATTTAATTTCTTCTCCTACCCAATCTCTACATGCCAGA
TTGCAGTGCACCTTCTAAGGCCCTTCCGAGTGCATGAGAGATTGAGCTTAGCAACAACAA
GTAAAACACCTATGCATTGAAAAGTTGAGTTGCTAAGCTATTCAATGCTCTTAGCATCAC
ATCTTAGCACCTTTGCATTGGAAGCAGCCTACTATGCCTAATGCATCAAGACGGAGGGAG
TATCGATAGACATTCTTGAGTCCCATCCAATTATGTTTGGTGGATCCAACGACATTATGG
AATGTTGAGTTCCAATATATCATTTTCATCATCTCTTGATCTAAATAGATCTTTCTCTAC
ATTTAGAGCATGAACTACTATGAGAATTATGGATGGATAAGATTCGTCCATAATGAATTT
CTCTAATATATTTTGGATATAGAAAACACCATAATGTATGAATGAAGGTGCTCAAGTTGT
AGTAGGTATTTTGGTTTATCCAAAACCTTCATTTTAAATCTGTCATTTAGATGATTACAT
GTGTCGTCATTACAAACACAACAATAATTGAATAATCATCGTTGTAGGAGTAATCCTTCT
GTATAAGGAACTCATTATGTCGGTTGTACCATATGTACTTATTGATTTTTTTACACAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1333, 2732..2929, 3021..3857
1001..1333, 2732..2782
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved