Hordeum_vulgare Locus HORVU2Hr1G075790
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU2Hr1G075790
Hordeum_vulgare
HORVU2Hr1G075790
chr2H
snoR103, snoR103, snoR103, snoR103, snoR103
1697..1803, 2581..2685, 2721..2825, 2897..3001, 3073..3177
5116
AGCCAAGCTAATGAACTAGCGCATCTCTGTACCAGACAATGTAGTTCTAGGATACATTG
TCTTTAGATTAGAGCAGCTCTAGCAGATCTCGCAAACCGGACCATCCGCTATAACAACCG
CCGGTTTGCGGGATGTATCCGTAAACCCGTCTCAGACATATCCTCTAAATTCGACCGTCC
CTGTTTTTTGTGGGATCCCGAATCCGTGAGCCCATTTCCTCTCTATATATGGGATTTCGT
CTGGTTTGAAGGACCCCCTTTCCTTTGACGGGAAGGAACTTTCAGCCCCATCGCTTTCCT
CGTAGCCGGCGTCATGGCTTCCCGAGCTCGATTTGGCCAAATCTCACCGCCGCCGCACGC
CATCGTCGCCGCACGCGAGATGTCGCATGTCACTGCTGTCTCCCGCCGCCGCCCACGAAT
TAGCTACTGCATGTTCATCGTGCCCGTCCCAGTGGTCCTTGTCTTGTTCTATGGCGGTGC
CTCCTCTATCCCTGATGAAATTCTCACGATGAAAGCGGTCGAGACGGATCAATTGTAACT
TAATGAATGTTTGTAGGGAGGTTTGTGCAATTTTACCAGGGCAATGAAATATTTTACGGG
ATCTGTTGTGCCGGAACAAAATTCATACCGTAAAATCACGAAAAAAGGTTTTGCGGTAGC
CTTTAAATCGATTTTTGCGGGACGGGTATATGAGATCTCCTAGAGATGCTCTTAATTATA
TCCTAGTTTTTTCTCATGGATGTGTGAGAAATGAGTGTCCAGCTATTTGATCAATAGTGC
TCTTGTGATTCATCAAAAAACAAAAAAGTCATACCAGATTGCTACACCAACGAAAAAGAG
GGTCCTGATCCTAAAAAAAAAGAGAGGGTCGTGCATCATTTTTGCCTATTCAGCCCATCT
AGGCCCACGCATGAGAGGACCATTTCCAAGGGGTTCATGATCCACCTTATACAGCAAGCC
TGAAGGCCCAGCCAGAGTCACTGGCCATCCCACGCTCCTCGCAAGGGCACAACCCTCGAA
AGCCGAGTCTTAGCAGATCGGTTAAATCACCCCCAAAACGCACCCACCACCACAACTCCG
GCGGCGGCGACCAGACGAAAACACGAGCACCAAGGCGATGGCGACTGCTCTCAACCGCGG
CCTCCGATCCGGGATCCGCCTCCTCGCCATCGGCGCCGAGGCCTCCAAGCCAGGCAAGGA
CTTCCCCTCCCACTCTCCCTCCTCTATGATCCGATTGGGGTTGCGGTTCGCGTCTTCGGT
TATTTAGTTTTGCGCATCTCGATTGATGTGTATCTGCGCAGCGGTAGATCTGTTTGATCC
GTGGAAATTATTCGGAATCTGTAACCGTAGTACCCGGCCGCTGTAGGATCGTTAATATAA
TTTGGGGAAATGGTTCGTCATAGGCTAAAACGGTCCCTCAGATGTGGATATGGCTGTGGT
TTTCGATTGAACAGGCCATTGTATCACCAGTTTTTACGTTGCCCTTCTTTCATGGATGGA
TCCGGCGACCAGGCTTGTCAGGAATGAATGAATACGAGTGGTGAGTGCTAGATGGACTGA
AACACAATTTGTTGACCACTTTATGACGTATTACACCGTAACCTAGACTGCCAGTTCCTG
TGATGGAAATGGTGAAGTTACTTTTCTTATGATGACAGTGTAAAAACATCTGATTGTAAT
GTCTATTTCTTGGCAAGCCGCATGAGTTGCGTATTGCTGTAAATATGGACAAAGAGTGAT
GTTGATGAAATTTAGGTGAGTATCGTGTGAGTTGTAGCTGCTCATAAAGGATCATCATAC
ATGCGTTCTTTGTATTGCTTGTTGGTTCATCTCTATGCATGAAAAGCAGGAAACAAACTG
TTATTTCAATATTTTTCTGAACTACCAGCTCATCACTTTCTAATGGGCAACTTTGTATTG
TTTGTTGGTTCACCTCTATGCATGAAAAACAGGAAACAGACTATTATTTCAATACTTTTT
GTCCCGTGAGGAAAATATTACACTATGTGTATGCTGCATGAATTGCAATCATCTTTTGTT
CCTAAATAATAAAATGTGTAATTTTGTTATGGCAGTCTTAAGAACTTCTGATCATAATTT
TTAGTGTTTAATTCTTGGCAAGCCACATATATTGTGTCCTGCTGTAGATAGGGACAACGA
CTAAAATTGATGGAATGCACATGAGAATTATGTGAGTGGCAGGTGCTCCTGAAAGAACAT
TAAACATGCATTCTAGGAGACTAAAAAGAATACTGTGCAACAATGTTCCTTAAATACCAG
CTTTAACCAAATCACTTTGAAGCTTACTGAAAACCTTGTACTGCTAGTTTGCTCATCTAT
ACGCCGAAACAAAACCTAGCTTTAACCCTTTTTGCTTATCTGTATTCTAATACTGCTTGG
TAGGCTGCTTGATTTGCATCTACTGTTAACCTGGACAAATAATAAGGTTGATGGAATTAG
GTGTTCATCATGCAAGTCACAGATGCTCATACATGACCATCACACATACACTTGGGAGAC
TAGTAGTGTGACCTGGTACACTTAACCCTTTTTGCTCATCAATGTCCTAATTCTTGGTAG
GCTGCTTGAGTTGCTCTCTGCTGTAAATATGGACAAATAATAAGATTGATGGAATTTAGG
TGAGCATTACCTGTCATAGATGCTCATAAAGAACCATCACACATACACTTGAGACTCATC
AATGTCCTAATTCTTGGTAGGCTGCTTGAGTTGCTCTCTGCTGTAAATATGGACAAATAA
TAAGATTGATGGAATGTAGGTGAGCATTACCTCTCATAGATGCTCATAAAGAACCATCAC
ACATACACTTGAGACTATTAGTGTTTGACATGGTAGTATAACCCTTTTTCTTCCTCCATG
TCCTAATTCTTGGTAGGCTGCGTGAGTTGCTTTCTGCTGTAAATATGGACAAATAATAAG
ATTGATGGAATTTAGGTGAGCATTACCTGTCATAGATGCTCATAAAGAACCATCACACAT
ACACTTGAGACTATTAGTGTTTGACATGGTAGTATAACCCATTTTCTTCCTCCATGTCCT
AATTCTTGGTAGGCTGCGTGAGTTGCTTTCTGCTGTAAATATGGACAAATAATAAGATTG
ATGGATTTTAGGTGAGCATCATGTGTCCTAGATGCTCATAAAGAACCATCACACATACAC
TTGGAGGCTAGTAGTAGGATTCTGGCATATCATCAAGATCCACCAGGGTTTTGGTGCCTG
TGATTTTTATTTATTGTTGTGTGCTTTGCACAACGTATTTATTTTTTGTTCCTTCATGTG
TGTTCTGGAAATAATTATTGATTTGTTTTGGATTTTTGTTGGTAGTATTCCTTCTGTACT
AACTGACAATGCTGGACAAGACTTTTGCTAGAACTCGCAGATTATGCTCGAAAATATTAA
TAAGGGTACTAATGCAGAATTCTTGGCATAAGGCCATGGACCTCATGGATCATTATAAAC
ACTCAATGGAGTATGAAAATGTAAAGAACTGAAGTTTGCTGTCGTAGTTTCGGAGAACTG
GAGATCTTAGTTGTGGGGATTGAATGAGCTGTGAACCCTTTTCTATATCTCTAAATTCGC
TCCTGCTTGCTGATTACCTGTTCTTTGTGTGTACATCAGCTTCACGTGGATTCCATGCTA
CCGGCGTGAAGAGGATGTCAGGGCACGGTCATGATGAGCCATACTACCTCCATGCCAAGC
ACATGTACAACTTGCACAGGATGAAGCATCAGAAGCTGACTGCATGGACTTCGGTGCTGG
GAGCCGTGAGCATTGGTGTCGGTGTCCCGGTCTTCGCGGTCGTCTTCCAGCAAAAGAAGA
CCGGCTCGGGATGATGAGCGCACATGCCCCTTTTCAGGGCCTACTTATTGGACTTATTTT
GAACTTAGCATTTTGTGAAGCCAAAGCTGTCACTTCAGTCTTGTTGTTTGGTGTTACTCC
ATTTGCTCTTAGCAGATGATCTGAATCTGTAAGCTCGTTTCTTTGCGGCTGTCGTACGGC
ACTGCTTTCTGTTAATAATACAAGTGGCTTGAACTTTCCAGGCTGTGGAGCGAGAAACCC
TTGCAGTGTGATCCAATTGTTGTTTGCGTTCCTCTTGGCACCTGTTGACGACTCTTTTGC
GCTTTGCATCTGTTTTTATACGTTCAGAGTTTTTGCTGTTGGATAATGATTGTTTAGTTG
GTATTATCTGGCGAAAATTGCTCAGATCATGGGTGGTGGATTGTTGTTGAAATTGCAAAG
TGCAAATTTGTAAGATGGCAAAAGAGGCAGATTCAAATTGGTACTCCCAACCTAGTTTAA
AACTGCGACACTTATTATTGATTATTATGGATCGGAGAGAGTACTTATTTGTGTATGTCC
CACTGATGATCAACTTTAATTTTAAGTGTCGGTGGTCTAATACAAAATTTATACTAATTT
AGTGTTAAATTTGCACACTTATTTTGAAACGGAGGGATTATAATCCAACTGGTGAGGTAA
AACATGAGAGCTTTGGCACATACGGGGCCTATCCGAAATTAAAAAAAACTTAGTACGGGG
CCTATATATACGAAATAAAAAAAAACTTAGGCCGACATGGCTCATCAAATGCCAATTTGC
GTCCATCTTATTCAGACAGACGGAGGGGCATGAATGAACTTTTTCCCAATAAACCCCTCT
TCTTCCATCAAGACGGAGACGGACAGACAGTTCCGTGGGCACCAGAGCCACCCCTTTCCG
TTCAGACGCGGCGGGAGATCGAATCGGCCTCACCCGCACGGCGATGGCGAAGACTCCGCC
GCCGCCGCTTCCTCTGCTGCTCCTCCTCCTGCTCGCGGCCTTCTCCGCTACCGCCGCCGC
GGAGGAGTTTCCGCGCGACGGGAAGGTGATAGACCTGGACGACACCAACTTCGAGGCGGC
CCTCAGCTCCATCGATTTCCTCTTCGTCGACTTCTACGCGCCGTGGTGCGGCCACTGCAA
GCGCCTCGCCCCCGAGGTACCGCTGCCGCTACTCGGCCTCACACACCCAGCTAGCTGACC
TGTTACTTGCCGCTGCTCCCGAGAGATGTGATGCGAATTGAGTTGTTTCGACTGTCCACG
ACGCGAGTTGAGATGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1192, 3639..4116
1117..1192, 3639..3853
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved