Hordeum_vulgare Locus HORVU2Hr1G063880
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU2Hr1G063880
Hordeum_vulgare
HORVU2Hr1G063880
chr2H
SNORD24, SNORD24, SNORD24
1948..2031, 2207..2290, 3192..3275
4687
ATAAAGAATCAAACCAACAAAAGCAACAAGACACAATAATATAAACTCATCAGATCTGA
ACAAACCTCCTGGGCACCATCACAAAAGGAACCAGAGTAACTTCATTTGCAAAAAAAACA
CCATGTCAACCACGAGAAACTAACGGAAGTCATGAAATTTCTAAAGATGTGAGGTCCCTT
TACCTCTTAGCGCCAAGATGGTAGCTGGAGGCGAGGGGCCAAAAGTATCTCCAGCAACGA
CATCTGTTCTCCACACGAACCCTATGCGATCAAGCGAGCAACCCCGGTAGAGGGATTAGT
TTTATTTTTAGGGAAAATACATAAAAAAGGTAGAAGAAATAAAAATCTCCTCGCCATATG
GCCCATGGACAAATTGAGACATGAGAGAGTCTAAGCCTATTAGCCTTTTCTTTGGGAATA
AGGCATATTAGGACTTTTTGAGGAGTACAGCCCATCAGAATTTTAGGTGACTAGGCCTAT
CATTCTTTTGTGGGAGCACTAGCAACCGCCCGGCCCAATCTGCTACCTCCCGGTCGCCTA
TAAAATCATAAACCCTAACGTCTTCGTGCTCCCCCCTCCGCCGCCGCCACCCACGACCAA
CACCGGAGCCGGAGGAAGAGAGGAAGGGAGAAGCCAACAGGTAACGATGGTGTCCGGCTC
CGGTGTGTCCGCGCGTCGCGTGGTGGTGGATGCGCGCCACCACATGCTGGGACGCCTTGC
GTCGATCGTGGCCAAGGAGCTGCTCAACGGGCAGCGCGTGGTGGTGGTTCGGTGCGAGGA
GATGTGCATCTCCGGCGGGCTGGTCCGTCAGAAGATGAAGTACCTCCGCTTCCTCCGCAA
GCGGATGAACACCAAGCCGTCGCACGGTCCCATCCACTTCCGCGCCCCCTCGAAAATTTT
CTGGCGCACCGTGCGCGGCATGATCCCGCACAAGACGCCCCGCGGCGAGGCTGCGCTCGC
CAGGCTGAAGGCGTTCGAGGGCGTCCCGCCGCCTTATGATCGCACCAAGCGTATGGTCAT
CCCCGACGCGCTCAAGTACGCGCCTTATCTTTCTCGCTTGCTCCTCTAATGGCGAATTTA
ATTAGTTATGTGGTGATGATCTTTGTGTGACTTATTGTTGGATAGGGTTCTGAGGCTGCA
GCCGGGTCATAAGTACTGCCTTCTCGGCGAGCTTTCCAAGGAGGTCGGGTGGAACTACCA
TGAAACTATCAAGGTACATTTTGTTACATCGATCACTCTGGTTGTCACCTCTGAACAAAA
TGATGATGATATTATGCATACATATGATGCTTTGATTCACAATGTTAGCTGTGGATGCCC
TGTTGGTGTAGTTTGTAGGTATCAGCCCGATTTTTATAGGGAATTTGAGTTAACAGCTTC
TCCCTGTGTGGCTAAGTCAAAATTAACTGTTGTTGAGCTGAAACACAGGTTAGGTTATTG
GTGGCCACGAAATAAGATTTTTGATAGTGATAGGGTGAAATGATATTGTGTACGCCTATT
TTACTGATTTTGACGAAAGGCAGTGTCCACGTTTCCTTTTGTGCTTAGCCTAGTAGATTC
CATTAGCTGCCTTGTCAAGTGCATTGATAACTTTTGTTGTGCCATTTGAATTTGTTATTC
TTTTATATTGCATTTGTGCAAATTTAGCATGACTGGGATGATGCAGAAACTCAGGACTGA
TGTCCATTGATTTTTCACAAAGATGATGCTCACAACCAGCTACTTCTGACTAGTCATGCT
ATTGTTTTTGACAGCACAAGCTATTTTAATTCGTCTTGTCCCCTTGTGTCCGATGTTAGA
CATGTTCTTTTTAGTCTGATTCCAATTGTTTTTTCTGATTAATCATGGCATTGGTCGCAA
CATATCCATGGAAAGATTCTCATGTTGTAACATTTGGCTGTGGCTATCATCATGTTCTTT
TGTTGGTTTCTCTTGTGTCTAAATGATATGCCTATGATGTGATTTTAATATTTGCTACTC
TTGATGGGTGCTCCCCAGTTGATGACCATAACCACCAAGATCTCTGAGGCTTCTCTAACA
ACCATGGATTCTCATTGTTATATAAAATTTGTTTGTTAGTTCGTTTCAATTATTTGAACT
CAGAAATCAAATTATAAAACTCGGATTGGGACTTCCATTCCTGTTTCCCATTTAACATTT
GGTTGTGCTGTTTAAGCCTATTCTTTTGTTTGATTGCTTCAGTTATAAGTCTATGATGTG
ATATTAATATTTGCTACTCTTGATGGGTGCTCCCCAGTTGATGATCATAACCACCAAGAT
CTATGAGGCCTCTTATGACAGACACGTCTTGTTTTCTTATTGTTGTTATTTTTTTTTTAC
ATTGTAAATGGGCAAATTTAGCATGATTGGTATGATGCAGAAACTCAGGACCGATGTCCA
TTGATTTTTCACAAAGATGATTCTTACAACCAGCTACTTCTGACTAATCATTGCTATTTT
TTGATTAATCATCTGTTACCTTGTGTCCGATGATAAGGCATGTTTTTCTTTTAGCCTGGT
TCTGATTAATTTTTTGATCATGATTTCTGATTAATCATGGCATTTGTCACAACACATTCA
ATGGAAACATTCTCAAACATTTGGCTGTGGTATCATCGTGTTCTTTTGTTGGTTTCTCTT
GTGTTCTAATGATATGCCTAGGATGTGATTTTAATATTTGCTACTCTTGATGGGTGCTCC
CGAGTTGACGACCATAACCACCAAGATCTCTTAGGCCTCTTTAACAACCATGGTTTTCTT
TTGTTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTATTTAAA
ATTTGTTGGCTAATTCATTTCAATTGTTTGAACTCAAATATTAAATCATAGAACTTGGAT
TGGGACTTTGATACCTATTTCTCATTTAACATTTTGCTGTGGCTTTTAGCCTGTTCTTTT
GTTTGACTATCCTGTGCTTCAGTTATAAGCCTGTGATGTGAAATTAATATTTGCTACTCT
TGATGGGTGTTCCCAGTTGAGGCCTTCTTAACATTCAGGGATTGTTTTCGCTAGTTTGTC
TCAATTATGTTAGTTCAGATCAGATAGCAAATCTTAAAACTGGGATTGGTTCTTAATACC
TGTTTCTCATTTAACATTTGGTTGTGGCGTTTAGCCTGTTCTTTTGTTTGATTCTCTTGT
GCTCGAGTTATAAGCCTATGATGTGAGATTAATATTTGCTACTCTTGATGGGTGCACCCC
AGTTGATGATCATAACCACCAAGATCTCTGAGGCCTCTTATGGCAGGGATGACTTTTTTT
TAAAATTTTGCGCATGTCGGTTAATGGCCATGACGAAGGTCTCCAATGTGATGTTAGCTT
CTTGATTGGTGGCTGTTTTTAATGCTTGATTTGAGCATGCCTTGAAAACGTATGTAGACC
TGCAACTATATGTAACTCACCTCTTTTTTGAACTGGCAGGAACTGGAGGAGAAGAGGAAG
GAGAAGGCCAAGGTCTCTTACGACAGGAGGAAGCAACTGGCCAAGCTGCGCGTCAAGGCT
GAGAAGGCTGCAGAGGAGAAGCTGGGTTCTCAGTTGGACATCCTGGCACCAATCAAGTAC
TAGCCTGCTGAGCAATCATGCATCGTCTATTTTGCTGGATAATGGTCGTTATTGTTTACG
TTAGTAGCCTGAGAGTGTCGATGAGGTTTCAAACCTATGAGTATCTATACAATTCCAATC
TTTGTAGCAAATGGATTGTTTGGTATTGTTGTTTCCCCCCCATGAGGTTTCAAGATGTTG
CTGTTTCCTCCCATAACTTCTTTTGCATCCAGCTCTTAGACAAGTCAAGCGAGCATAGCA
CATTGATATGCTGAGTTATTTGCACTTCTCCTAACTTGAATCGAAAAGGAGGCAAAACTG
AGAACCGGGAGCACCAGGTTTGGACAGCAGTGACCTGGCGCCACATGTCATCTGGCAACA
CATTAGAGCATGGTTAATAGTATGGTCAAGTGTTGGCTATAAGGGGGGTGTTTGTTTTCA
GGGACTTTTTGGTGTAGGGACAAAAAAAAGTCCCTTTTAGTCCCATGTGAAATAAACATG
AGGGATTTTTAGGGACTAAAAAGGTATTTGAGACTAAAGGAAGAAGTCTCTATGAAAGAG
TCTTTTTGGGATTTTTTGACCATTTTTTCCAACAGTGCCCCTATTTTTAGCATGTCATTT
AATAACTACTACTACATTACTAGGGTTAACATGGTCTTTATGCATGTCATTTTATGACCT
CTAGTTCATGAAAACAAACGGTTAGGGACTATGGACTTTTTAGTTAAGACTATAAAAAAG
TCCCGGGACAAACAGGGCCTAAGTCATCTTATGGTCTATTTTATAGCTAGCTTGTACAAT
AGTTAGCTATAAAAGAGTATTACTTTTATCATATATGATACACATTTCATTCTCACAAAG
CACATAGGAGCACGTGTTAGAGTTAGTTCTTCACGAAGAGTCCGTTTTCCTTCTCTCTCC
TCTTCTTTCTCATCCAACTCAGTAAAAATATAGTATTTTAATCCTTACAGCCCGTTGATT
ATACCTTAGAGCAAGTATAATAGTATAGCCAGCTGCTGGCTATAAGCCATTGCCATGTCA
TCTATAGCCCATCTTATAGCCAACATGTACAATAGTTCATTACAAAAGTGTACTATTTCT
TTATTATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1034, 1123..1212, 3459..3687
1002..1034, 1123..1212, 3459..3602
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved