Hordeum_vulgare Locus HORVU2Hr1G031940
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU2Hr1G031940
Hordeum_vulgare
HORVU2Hr1G031940
chr2H
snoR135, snoR135, snoR135, snoZ43, snosnR60_Z15
3769..3913, 3993..4138, 4189..4333, 5662..5756, 6087..6182
7788
CCATGTGTTGGCCTCTCCTCTAGATCATAGTTATTCCTCTAGATCGGCTTTCTGCGGAG
CTCGGGCGGAGCCGTGCAGGAATAGATCACCACCACCACCGGAGCGCCGTCGCGCTGTCG
GGGAACTTATCTACATCCCCGTCTCTCTTTTTGGATCAAGAAGACGGAGATCGTCATCGA
GCTGTACGTGTGCGGAACGCGGAGATGTCGTCCGTTCGGCACTTGATTGAGACGGATCAC
GAGACGGTTCGTGGGACAGATCGTGGGACGGTTCGTGGGATGGATCGTGAAGACGTATCA
CTACATCAACCGCGTTTATCAGTGCTTACGCTTAGCGATCTACAAGGGTATGTGGATCCG
ATCTCCTTCTCGTAGATGATCATCATCATGATAGGTCTTCGTGTGCGTAGAATTTTTTTG
TATCCCACGCAACATTCCCCAACAGTGACATTATGAGTCAGGTTCATTCATAGATGATAT
CTCAAATAAAACATAAAAGAGTTTGTGGGCGTTGATGTTCTTTTTGTTGACCTCTTTAGC
CTTTTCTCGATTCAATGATATATATATAAAATATCTAAAAATATGTAAAAGTAAAATAAA
CGAGGTGTGCCGTACCGGCCCGCGTGCCCATCCTCCAGACCGAGGCACGGTCCAAAACGT
GTCGCGTGCCTGACACGACATGTATAAGGGCATCTTCAATGGTCGTATGATGATCATTGG
TAAAATTGTCACATAGATGATTTTGATGACATGACCATAATAAAAGAAGAAAGAGAATGA
AACCGTATGAACTTGAAGCAACGGTTCATGCACAAGCTCCGAGGCAAACATGGTTATTTC
TTCAACATTTAATGGACCCACTTAGTTATTTTACATACGGTTAACATACACTCTATTGAA
GAGCTTGTATGATGTGTTGTTGGTTGATGATGTGGACACTTATAACAACGATTGAACATA
CGGACTATTGGAGATGCTTTAAGTCGTGTCGTGCCTAGCGTGTGGGTTGTCGGGCCGACC
CGACTAGGACGACCAGTTTTGGCCAGCTTTGAACGGAACTGCGAGGACTGGGCGGCGGCC
CGATAGATAGCCACGGCGGCCCGACCGGCCTAAACATTTGCAGCAAAACCCTAACGCTCC
ATCGATCTATTATATATTCGCAGTCGCTCCTCATCGTTTCCAAATCCAAGCCTAGGGTTC
ATCTTCCGCCGCCGCCGCCGNACACCACCTCCCTCCCTTCTCCAACATGGCTCTTCAGAT
CAGCAAGAAACGGAAGGTACGAGACCGGGCCCTCTTCCTTCTCGATCCCCAGCTTGATTA
GAACACATGTAGATTCTTACGCGCCGTTGATCGCTCGCAGTTCGTCGCCGACGGCGTGTT
CCTGGCCGAGCTGAACGAGATGCTGACGCGCGAGCTCGGGGAGGACGGCTTCGCCGGCGT
GGAGATCCGGGTCACCCCCATGCGCACTGAGATCATCATCCGCGCCACCCGCACCCAGAA
CGTCCTCGGTACGTGCATTTCCCGACGGCAAGCATCCCATGTCTTCCTATTGTTTCCGAC
GCCGGATCTGAGATTTTGTTGCTCTGGTGGCTGCTGATGTTTGGCCTTCAGGCGAGAAGG
GCAGGAGGATAAGGGAGCTGACGTCGGTGGTGCAGAAGCGTTTCAACTTTCCCGACGGTG
GCGTAGAGCTCTACGCCGAGAAGGTCCTGAACCGCGGATTGTGCGCCGTCGCTCAGGCCG
AGTCCCTCCGGTACAAGCTGCTCGGTGGCCTTGCCGTCCGAAGGTTATTCCTGAACCCGA
ACGCTCTGAAGCTTGTGTTCATTACATATATGCATAGCGTACTACCATGTCATCTTCACA
ACATGCCTGGCTCAACTACGCTGGACTTGTGTTCGATGGTGACAGAAATCAATTGTTGCC
CTCCATTGCTTTCTGTAAGCAGTAGAGCATTTTTCTAATGTTTTCGTTGCTTTCTGCTTT
GGAGTGAACATAATCAATGAATCCTTTTTAGGTTATTATTATCATATTATGGTTCTTGTA
GCATCGTTTGCTGTACTGTCATGTCATCTATAAAGCAAATAGGTCATTTTATGCCAACTT
TGTGTCGGAAGATGACTAAATTACCTGTGCCAACCAGCTTTCATTTGCTGAGAATCTTTG
CTTATAGGTTTCTAATGCTTTCCTATCTGGTTGACCACATTACAATTTGCTTTCACAAGT
CCTTTCTTACGTCAGGATATAACTTGCTTAACTGAATTATCGTATTGCTCTATGAGTCTT
ATCAACTGTTATTTCGGGCTCTCCTTCTACTTAGTGATACTCCCTCTTGTTGCCCTCTAC
TGAGTAGATGCATGTTGCTACTAGTTTCGTAATCAGTAGATGCATGTTGCTACTAGTTTC
GTAATCAGTAGATGCATGTTGCTACTAGTTTCTTGTTTGGAGTGAACAAGACCAATGAAT
CTTGTTTTTGATAGGTTTCTTGTACCATCGTTTGTTATATGTCATCTATAAAGCAAATAG
GTCTCTATGCCAACTTTGTGTCGGAAGATGACTAAATTATCTGTGCCAACCAGGCTTCAT
TTGCTGGGAAGCTTTGTCTATAGGCTTCTAATGCGTTCCAAACTGGTTGTCCTCATTACC
TTATTGCTTTCCCAAATCTTTTCTTATGTTAGTGTAGGCAGTTAAAATTGCTAACTGAAT
TGGATTACAGTTTTTAGTTTGGTGCTCTTTGTATAATTTACTTGATGTACTTGCAGAGCA
TGCTATGGTGTACTCCGATTTGTAATGGAGAGTGGTGCGAAGGGCTGTGAGGTACCTGTT
CTGTTGACAATAATTTTTCTTGTTTTGGTTTGAGGCAATTTGCGCTTGTGTACTTATAGA
GCGTTCTTCATTTGTAGGTTATTGTGAGTGGGAAGCTTAGGGCACAGCGTGCGAAGTCCA
TGAAGTTCAAGGATGGCTATATGATCTCTTCTGGCCATCCTGTCAACCAGTATATTGATG
GAGCTGTGAGGCATGTTCTTCTGAGACAGGTTTGGAGCTACTTCACATGGAATTAGTTGC
TATGGATAAATGGTGTTCTTAGTGTATGTAACTTAGCAGATCTTATATTTCTTACTTGTT
TTCAGGGTGTGCTGGGCATCAAGGTTAAGATCATGCTTGACTGGGATCCTAAGGGAAAAC
AAGGACCAGCTACGCCTTTACCTGACCTTGTAACCATCCACCCACCTAAGGATGATGATG
AGTTCCTGAGGCCTCTTGCAGCAGAAATTGCAGTTGCTTAAAAGTGAAAAATTAACATCT
GCCTAGGGGTATTTAAGAGTTTAGGTTGACTGATGCTATGGTTCTGGATTATGTAGTTAT
GCTTTTTATTTATTGGCTTCATCTTTTGAAGTTCAAACGACAGTAACCAATATATATTTC
CAAATTTCATGTTGCTATGGTATTGTTAGAATGTGTTATCTGATATACAGTGATAATTAA
ACCTAAGAGCTACAACTTGCTTTTTATATTTGTGTTACCTTCTGTTCTTTTATGTTATAT
GCAAGTGAAAAAAACTATGATTAGTAATTCGTAGGTTCTATGATGCAAAGTTTTATGCAC
ATTGTACAGTATAGTTTGCATCGGATTATACACTTCAGTGTCCTAAGCTTTTAATTGCTT
TCCACGACAATCACTTCCCTCCCTTCTAATCTGTCATCTCTGCTTTTTGCGTGATTGTTG
TCGCTTCCATATCGATTTTGTTTCCTTTACCTTTTCCTCCCTTTTAGTCTTTGCAGGATA
AGTGTGTATCAGTTAAATGCTTTTGCTATGCATTTGTTACTGAAAGTAATTCCTGCTATA
TTAATTTGTGGAAAGTGGGCAGTTGGGTTGAGCTTGATAATCTCTGTCACCAACAATCAT
TTTCCTCTCATTGTCCTTCCTATGTGAGGTGACTGCTTCTGAATCTATCTTCTTTGCATA
AGAATTTGTTTTGCTATTTCTCTCCTTGTTGCATTTGCAGGATAAGTGTGTATCGGTTAA
ATGCCTTTTGATGTGCATTTCTTACTGAAAGTGTTTCCTGCTATATTAATTTGTGGAAAG
TGGGCAGTTGGGTTGAGCTTGATAATCTCTTTTGCCAACAATCATTTTCCACTCATTATA
TTCCTTCAAATGTATCTCATTGTTAATTTTATGCCTTCGGTATGCTGCCTCTGCAGGATA
GGTGTGTATTGGTTAAATGCTTTTGCTCTGCATTCATTACTGAAAGTATTTCCTGCAATA
TTAATTTGAGGAAAGTGGGCAGTTGGGTTGAGCTTGATAGTCTCTTTCGCCAACAATCAT
TTTCCTGTCATTTCATATGCATCTAATTGTTATTTCTATGCCTTTGCTATATGCACTCCT
CCTTTTGATGAAATTTATGCTTTGAGGTCTTCTTGTAGGACTAGCATGATTCGCACCACT
ATGTGTGGGCCTGTGTGGCTAATTGGAAAGTTTTGTAGGCAAATCTTACATGGTTTGCTC
AAATCATTTTTCTCATTTTACCTTGTTTTCTATTTTAACCTTTTGTATGTGCATTTGTTA
TATCTTGTAGTTGGTAGTTGTATGCTTGTCTGTATTTTCTGTTCTTGACATTTGTTCAAG
TTTGGCCAGTGATGAAAAACCTATTAATCATACCATCTTTCGGGACTGATTGGTCGCTAT
GCGTCCATGCTGTCATTCTGCAATTCTGAGATCAACTTGATTAGTGTCTGTCTTTGTTTT
CTGTCATGCCCTCTTTGATTGTTGAGTACTGTTTCCTTGTCTTCCACTATTTAATTTCCT
TTTTTTTTTGACATTTCCTAAATCCTGAGTTCTTTTTGCTACTGCTGGTGAAACCATTTA
ATTGATTTAGCTTGGCTGGTGATGAAAAACCTATTAATCATACCATCTTTCGGGACTGAT
CGGTCACTATGTATGTGTCCATGCTGTCTTTCTGCAATTCTGAAGCCAAATCGAACAGCT
TTCGAATGTCCACTTGAATTTTGTTGCATTCTTTAATATGTTATTTTTTGAGACACTTCA
AAATTCAGTTGTTTAAAGGGATTCGGAATCAAATGTTGTGGTATGGATGAAGATCTGCAC
TGGGCTCCGAGCAGCAAACATTGTTGCGTCCTGACGGAGATGCATTTGCCTAGAAAGCAT
TGTCTGACGTCTCAACAGTGCACTTAAAAACCATTTGCTCATCTATTGAAGCAGCATTAG
GGCTGCATTGTACCATGGCTTTGGTTCTTTGTACCATCGTCTTGCCTGCCAGAATCGGCT
GTAGTCAAACCACTAAGGAAGGAAATCTGGTCGGCCTGCCAATATCATTGGGCAACCCGC
TTACCAACCTTCCTACAGCTATTTACCATTTGTTCCTATGCTTACCAACCTTCCTACAGC
TATTTACCATTTGTTCCTATGCTTACCAACCTTCCAACAGCTCTTTACCATTTGTTCCTT
TTTTTTGTATGATTCTGCAGTCCTGTAGCATTGGGCAGTAGTTCTACCATCTCAAGTTCT
GGTCATTGTTGATTCTTGTCCAGCGTAGAAATAGTGCTTGCTTTCACTAGAAACTGCAGG
ATTTTGTGTCTTGAGCATGTTGCAATTTGTGTGCTTGTTTGTCATCCTTTTTTTGTTCGT
CCTTGATTTTCCATCTTGTTGAGGACGGTGACAATTGATATTTGGTCTCGTTCATGGTAA
CTGGCATCTTCTTTTGGTCGACCATTCTGTTGTATCATCTCCCATATTCTGTGTCCTCTT
CTGCATCAAAATGTTTTCCCTCTGCTGATGTGTTTGGGTTTAAGTAGTTTGTGTACGTTA
GTGGGGATTAGAGACTAAATTATAGACCATGCATGTCTGAATTTGCTTCATGTGGAATGA
TCTAATCTTCTCTAGCGGCCAACGATAGTGCTTCTTTCTAAGATTTTGCTTCTTTCTAAG
CTATGCGCCCAACAATATTGCTTCTTTCTAAGATATTGCTTCTTTCTAAGCATGTGTCTG
AATTTTCTTCATATGGCACAATGTTTCTATGATTTTTCTTACATATTTCTGTCATTCTCG
TTCTTGCTTTCTAATATTGGTTTTTCACAAGGTTATGATGAACCCAAGTGCATAGTTCAT
ATGATTAAGTAATAATGTTTACTTGAACAAGAATAGTCTTTCGCTCCTATCTGATCACCT
TATACATTTTACAGCTCGTTTGGCATATCATTTGGTCTGGAATTCATGGATTTCATTTTT
GAATTCCGAACTCAACGCGTTTGGCTGTCACAGATTTGGGCATAGGAATTCATTCCACAA
TTCCAGCGAAAGGTTACCATAGCTAGGCCGAAATCTTTCCCCACACTTCCTGTGGATTTG
ACGCATCTTCCCCACACCTCCATCCCAATCCCTCTCCTACATCGTGGTCCCTCTCCTCTC
CTCCTAGCCAGAGTGCCAAGGTCACCCCTACGCCGCTGCTTGCCAAGGTCACCTCCTCAC
CGTCGGTCAGATCGTGGAGAAGGCGGATGCTGCCGATGGCGGTGAGGATGCTGGATGCTG
ACGGAAATGTGCGATGGTGATGAGGTTGAGCCCATGCTGGAGCCGACCGACGAACCAGGC
CTTGTTGGCGTGCCCATGCCAGATCAGCGAGCTGTTGCTGAGACCAGGACGATCATACAT
GAGTGTCTCGGTTGCGGTTTTCTTTTACTTGCAAGTTGCAACAGCACATCTATCTGTTTG
TTGTTCAGATTGACAAATCCATGTCGAGCAAAACATGTTTTGTGTAATCGGCCAAACGAG
CTGTTGTGTCTTTTATTTACATGGAACCTTGCATCTCCCAAGATTATTGCAACAGCTGTT
GTGTCTTTTATTTACAAGAAAGTCATTTAGTTGAAAGCCCATTATTGAGAAAGATGAATT
AAGTCAATTCGAGAATTCTCCTGGTGTGCTTTCATTGATTATTGAATGGCTTTAGGAATT
GAAGTTTAACATCCTGTACCATATGCTCATATACAAAATGGTTTGTCTTAATTAAGAACA
TCAAATTCATTGCATGGTCTTTGTTGATGAATTGCAATTTGCCAACTCCTATTTGGGGTC
ATGCTATTTTACATGTTGCTGACTTGATACAATGGAAGCCAACTGCATATCATAGTATTT
TCTTTGTAGCAACTTGATACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTCCAGGTCCCGCTATTGGATATTGACCGAGGAGTCTCTCGGGTCATGTCTACATAGTTC
TCGAACCCGCAGGGTCTGCACACTTAAGGTTCGACGTTGTTTTATGCGTATATGAGTTAT
ATGGTTGGTTACCGAATGTTATTCGGAGTCCCGGATGAGATCACAGACGTCACGAGGGTT
TCCGGAATGGTCGGGAAACGAAGATTGATATATAGGATGACCTCATTTGATTACCGGAAG
GTTTTCGGAGTTACCGGGAATGTACCGGGAATGACGAATGGGTTCCGGGAGTTCACCGGG
GGGGGCAACCCACCCCGGGGAAGCCCTTAGGGCAAAAGGGTGGCGCACCAGCCCTTAGTG
GGCTGGTGGGACAGCCCAAAAGGGCCCTATGCACCAAGGATAAGAAATCAAAGGAAAAAG
GAAAAAAAAAAGGAGGAGGTGGGAAGGGAGGGGGACTCCCTCCCACCAAACCTAGTCCAA
CTCGGTTTGGGGGGGGAGAGTCCTCCCCCTTGGACTCGGCCGACCCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1275, 1360..1507, 1611..1782, 2756..2810, 2897..3028, 3125..3323, 6194..6788
1246..1275, 1360..1507, 1611..1782, 2756..2810, 2897..3028, 3125..3280
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved