Hordeum_vulgare Locus HORVU2Hr1G001310
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU2Hr1G001310
Hordeum_vulgare
HORVU2Hr1G001310
chr2H
snoR103, snoR103, snoR103, snoR103
3329..3437, 3610..3716, 3792..3899, 3954..4062
6236
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCCGCGTCTAC
GACCGGATGCGGGCCATCCTGGTCAAGACCCACCGGGACGTGGAGAGGCTGCTCGCCGAC
CGCACGCGCCTCGAGGGGCTCCTCCAGATCCAGCACGACTTCTGGCTCCGCCACCACGCC
GTCCTCAGCGACGGCCTCGACGAGGTCCGCCCCTCCCTGATTCCATCCCTTTTCCATCCT
CCCCCGCCCGCCTGACGGTCCCTGGTGTTTCGTTGGCAGACGCGGAGGGTGGATGACTGC
GTGCAGCGGGGCGACGCGGCCATGCTCCACCAGCTCCAGGACGAGAAGGACCTCGAGTTG
CGCCGCCACCGGGACTACATCGGTAAGAGCACAAAATCCCCACCCCTCCTCCCCCCTATG
TGCTGTTTCCTCCTCTTCTTGCCGATTTGGTGGCAGAAATCCCGGGCCATGGGCTCTCCT
GGAGGGATTTGGGTTAGCCTCCAGGCGCGAAAGCCGGCGTCTTTTTCGGCATAGGGGTTG
TTCCCGGGACGCCAAATGTTCCATCTTTGCTTGCGTTCGCTGTGCGTGCAATGCTTGGAT
TCAGATTGTTGTGATGCTCCTTTTGCGGCGGCATGCCTGATGTGAATTTTGTCAAGATTC
TCTGTATGTATGAATGTATGCATGCTGCCGTGCTGGTTTAGTTATTTCTACGTTTCGCCC
TTCCAACATTTTAGGGAATTAAGTTGCATGCTAATTCACCAAATGTATACATGATGATAT
TGTTTGGGCTTCGAAATTTGTTAGTCGCGGCTGCAGTTCCTGCACTGCACTGTTGCATTG
CTGGACACCAAAGCAGTACTCCAACGATGACATTTCGTCATGTCCACAGCTTATCGCTCC
CGCTCGCATTCATCAAGAACCGGGATTCCTGGCAATTGCGACCCACTTAAAGTGGCAGCT
AGTGCTTTGCTTTTTCCGTTTAGAATAACATTTTGCCCATGATTTATGTTGCTGCTGGTT
GCTGATATCATTGTGTTTTTGTGTTTGATGTACAACACCAAGTGCTTTGCTTTTTCCGTT
TGGAATAACATTTCGCCCATGATTTATGTTGCTGCTGGTTGCTGATATCATTGTGTTTTT
GTGTTTGATGTACAACACCAAGTGCTTTGCTTTTTCCGTTTGGAATAACATTTCGCCCAT
GATTTATGTTGCTGCTGGTTGCTGATATCATTGTGTTTTGTGTTTGCTGGGATGCAGCTG
CTTTGACTGAAGAAAACAATCAGCTGAAGGTACTTAACCGAAACAAAGTTGCGTTACCCA
CAAGCACGCAGTGAAACTTGTCCATCTCGTTAAATGGTGTTCTGTGTCTGCTCCTTTTTT
CTTTAGATAAAATTGAAGGAAGCTGAAAGTTGTGCCGAGCTCAGCGAGCCGAGCACAGAC
CCCGAGCGCAGTGGAAGAGATTTGAAATCAGAGTTAAGGAAGCTAAAGAAAGCCTATAAG
GCCCTGAGCTCACAGAAGGAGACTGAGGTTTCCGCGTTACTTGCAGAAAAGGATTTTGTG
TGGAATCAGTTCAAGATGATGGAGAAGGACTACAAAGCGCTCGTTAAGAAGATGGACAAG
GAGGCAGCACAGGCTACTGAAGCAGCAGAAAAGCTTCAGCAGAAGCTGGAGGAGCTGCAA
CTGCAAGTGGTGGCCCAAAAGAAGGATGATGATATTGGCAGATTGCAGGCTGAAGCTAAT
GATGCCAAAATGAAGATGCTGGCTCTCGAGGATAAGCTACATAAAATGCACTCCCTGGTC
AGTGAGAAAGATGATGAAATCCAAAAACTCAAGAGTGGGCACCTTCAGGCTAGTCAAAAG
CAGAAGGATATCAACGGGGCACGAAGAAAATGTAGGTCTGAAGGTCCATCTGTACGGGGC
AAGTCTAAAGGTAATCCTCGGAGGCAAATAGTAGAAGAGGATCAACCAGAGACCAGTCAG
AAGCGTCAGTGTCCCTCTTCGTTATCTGTACGGGGCAAGTCTAAAGGTAATCCTCGGAGG
CAAATAGTAGAAGAGGATCAACCAGAGACCAGTCAGAAGCGTCAGTGTCCCTCTTCGTTA
TCAAGTGTAAGTACTCCATTCCCAAGTATATCATCCGTGTACTGAGCTACTGACATGCTC
CGCTGATAACCTAGATGCTAAGTTCCTGTTATAGAAAAATTTAACTTTTCCTGTGACTGT
AATGTCTAATTTCTTGGCAGGCTGCATGAGTTGCATTTTTCTGTACATATGGACAAAGAG
TAATGTTGATGTAATTTTAGTGATTATTATTTGAGTTGCAAGTGCTCATAAAGTAAAAGT
AGCATCACACGTACTGAATTACATTCTTAAAAAACTCAGAACCAGGCAAAATACGGCTCT
GACTTACCAGTTTATCGCTTTCCAGCTAATGGGTAACATTCTACTGCTAGTTTGTTCATC
TATATGTGTAAACAAACCTAACCTGCAGAGAGGAGATATTATGCATCTTATTGCATTTGA
AACCCCCTCCTTCATCAGCTACAATATCTTAATTCTTTGTATGTCGCATGAGTTGCGATC
AGCTGTTGTTCATAAATAGTAAAATCTACAATTTACTTGTGTCAGTAGCAACTTTTCACA
AATAATTGTAATGTCCAATTCTTGGCAAGCCGCCTCAGCTGTGTCTTGCTGTAAATATGG
ACAAAGAGTTAGCTTGATGGATTTTAGGTGAGCATTATGTTCCTTGCTAGGTGCTCATGA
AGGACCATCACAGATAAATTCTAGGAGAATAACAAGGACATGGCCAAATATGTTCCTTGC
TTTTAACCATGTCACTTTCAACATTTGGTTTGTTCATCTATATGCAGAAGCAAGACCTAC
CCTGCAGAGTAGAATAACATATCACTCTTGACACTAACCATGTGCTCATCTATGTCCTAA
TTCTTGGGGGCCGCATGAGTTGCGTCCTGCTGTAAATATGGACACATAATAAGGTTGATG
GAATTTAGGTGAGCATCACTGAGTCATAGATGCTCATAAAGGACCATCGCATATACACTT
GGGAGACAGATTAATAGCAAGGACACGGCACTGTAAACCTTTTTGCTCATCTATGTCCTA
ATTCTTGGTAGGCTGCATAAGTCGCATCCTGCTGTAAATATGGACAAATAATAATGTTGA
TGGAATTTAGATGAGCATCATGTGAGTTGTAGATGCTCATAAAGGACCACCGCAAATACA
CTTGTCGAGACTACTAGTAGGACATGACTCATCTATGTCCTAATTCTTGGCAGGCAGCAA
AGGTTGCATCCTGCTGTAAAATATGGACAAATAATAATGCTGATGGAATTTAGGTGAGCA
TCATGTGAGTCGTAGGTGCTCATAAAGGACCATCATAGATACACTTGTGATACCAGTAGT
AGGACGGCAACATATGCTGTTTCCAATGTCAGTATCTCATCTGAACTATTTCTACACCTG
AGGTGTCTAGTTTTTTTTGTCAGCGTGCATAGTCCAAAATTACACGACAATGAGGGTCCC
GATCATCTTTGCCTGTGTCGCTTTTGAATTTTTTGCCTCACATATTGTGATGTCCTAATT
CTTGCTGTGCTGACAGAACGCCATTGGTGCATGCAGGGAGTGGCGCTCGGCGGCCGCCCA
TTGCATAAGACGCACCGGAAACCCGTGCCGTCTGCGTCCCAGCAGCACGTACTCTTCTCC
GCCAATTTTAAGGTCCCAAAGCTGAAGGCCCCGCCCCTCCTCCTTCGTAGTAGTCTGATC
TAATTGCATTCTGACATGTGCAGCTGCTGTTAGACCTCTGCGATGCCCAGGGATGAAGCC
AACATGCAAGCATAGGGGGGGGCAAGTTTGTTCATGGAGGAGGCAAAGTTCATATGAAGT
AAAAAAAAATAGCTATAACAACCATTGTTATATTAGAAAAATAAATTTGTTAGGGGGGGT
CTAGCCCCCCCTTGTCCCCCCCTAGAATCGTCCCTGGCGACGCCGGTGTTTAGGTGGTGT
GTGGAGTTAGCGATGAGGTCTGCTGTTAGACCTCTGCGATGCCGGTGTTTAGGTGGTGTG
TGGAGTTAGCGATCATGTTTAAGCTTTATCTTGTGCCGATCGTGGCTTTTAGCATACATC
CTCGACCTTATTTTGGAGGCTCTTTTGTAGCATATTCGTGGGCGTTGCGTGAACCGAAGG
GCTCGCTGACCGGTGTATGTATGTATGTCTGTGTGTGTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTGTGT
GTGTATTAATCGTGTGTGTGTGTGTATTAACCTGGGGGCCGGAACTCGCGAGGTGTTTGT
AGATGTGACGCAAACCCCCCTCGGTTATATGTGTTTGTTTCTATCGTTGGTGTGTAAAAT
GTTGAGTAGCGTTTGAATTTGCGCACTGGTGAACTTGCTTAGGGCTTTCGATGGTCGAGT
TGCGTTGTGTACATAAATGTGTGGAGATTCAGTTTGGATGATTGATTTCTGTTTGGGAAA
ATTGTCGGTTGTTGTCTAGCCATTTGAATTTGTGCTTTTGTGAATCTGTCAATTTTTTTC
CCTCCATGGTGAAGTTGCGTCATCCACCACATAAATACGAAGAAATTTATTTGCACCACA
ACATTTGAGAGGAATAAAGCACACACTTCATATTTGGGCGTTTCTTGGTGTATAAACCCC
CCTGCTAAACAGGCGCAATGACCGCTGAAACTAGGCGATGCTGCTGCGAAAAGTAAGTAG
AAAATGGTTCGACATGGTAAATTTCCCTTATTTTTGTGAGAATTCTTTTGTTTTTGGAAG
AAAGCACATATTTATTTATATTTACGTAAAGAATTCTTGGGAAAACACACAGTTTCTCTT
TAAACCAAACTTGTAAAACAAATGTAATGTAAGAAGAAGAAGAAAAAAAACACAAGAAAT
CCAAGACGGAAGGAACTCTTCTTCTTGGAGCACAAGAAGGAAGAANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1041, 1916..1948, 2046..2765, 4296..4391, 4463..4897, 4972..5236
1003..1041, 1916..1948, 2046..2765, 4296..4391, 4463..4495
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved