Hordeum_vulgare Locus HORVU1Hr1G088760
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU1Hr1G088760
Hordeum_vulgare
HORVU1Hr1G088760
chr1H
snoZ43
4066..4155
5272
GAAGGTAATTTAATATTACAAGATACCAAGCAAGCAATCCTGAACATTTATCTTGCCAT
CCTCACAAGCATCGCTTTGCCATTCCAGAGGGCGCCAACTCGCCCACGGAGGCTACGACC
CCGAACCAGGAGTCCACCGAGGAGGCCAAGGCAGCCGAGAACAAGGAATCCACCGAGTAG
CTCCCATGTCCTTTTTTGAACGGAACTCTGCCATTTGCTATGCCCATGCCGCCTCATTGC
TCTAGCAATAAGTATTCCGGACGTCGTGTAACGCCTGCTGAATTTTGAACTGAAGTGTCG
CAGACATGCCGTTATCCACCGTGCTATGCCATTCCATGGCTGTCGATGCCTGTAACGAAT
TCGGTATATGGGACCGGGAACATTATGGTGTCGCACCGAGTGTTGTCCAGAGTCGGACAG
AATAAAAGCGTGAGAGCCTGAAATTTATGCTGGTGCTGTGCTGTGCTGTGCTAGTTTCTC
CTTCCTGCAGTGCGGTGCAGCGCTGATGGTACCGTGCTGAACCGTCTGCTCCCTGCTGTC
TGAAACCTGTGATGTTTTCTCCTCTATGTAAGATTGTCTGTTTGAATTCTGCGTGGTTTC
ATGGAGTCCTGTAGTCCGGTTTGGTGTGTTAGTCTATGGTGCCTTGGAACCCTAGCGGCT
TCGTTTGAAATTGCTGAATTCCAAATGTGTTGATGACATGATTTCAAAAAATGTTCTGAA
CTAGCGTATACGATATTAACTGGAGAACGTTTCTTCTGAACTTATAGGAAATCCAAGCAC
TGCCAATCACTTCAAATATGTTTTTTTAAAGATCATAGCCCAACGTTGAGAGATCTGATT
TCTTTCTTAATTCTTATACAGTACTCCTATATAACAGAGATCTGATAGGTTCTTAACGGG
CCGGGATCGGACGCTGACACGTGAGTCCACGGAGCACACGCTCAGGCCATAGGCCCGGTA
GAGGCCCCTTAGAAAATAAATATTCGCTTACACAATCCCTAAAGCCCCATCGTCCCGTCC
TCCTCCATCGCGTCCCACGCAACCCTAACCCACCCAGCCCCTCGCGCCGCCACCTCCCTC
CGGATCCACACGCGCCGCTGCCGCCGCGATCATGGGCTTCGACGTGGGCGTCGTCCCCTT
CAACCCCGATGGCTGGGGCCCTCCCGACGCGCCGGGCGCGGCGCCGCTCCTGGGCGGGGC
CGTCGCCACGGCCTCCATCCCCTTCGCGCCCTTCTCCCGCTCCGACAAGCTGGGCCGCAT
CGCCGACTGGACGCGCAACCCGGGCCACCCTGGCGCGCACGGCCACCACGCGGCCGCCGC
GTCCCGCGACTCGGTCTTCGACTTCTCGTCCGCCGACGACTCGCTCGCCGCCGCCGCCGA
GGACTCGTCCTTCAGCCTCGTGGACGCCAAGCCGCCGCCCAAGCACCCGCGCTTCGGCCC
CAAGTGGCGCTTCAACCAGCGCCCCCAGCTGCCCCAGCGCCGCGACGAGGAGGTCGAGGC
CAAGCGCCGCGAGGCCGAGAAGGAGCGCGCCCGCCGCGAGCGCCACTACCAGAACCACCG
CTCCCACCACCACCAGGGCTTCCGCGGCAACCAGCAGTCCTCGGCCAAGCCCTCGGTCGA
CATCCAGCCCGACTGGACCATCCTCGAGCAGATCCCCTTCGCCAACTTCACCAAGCTCTC
CTTCGCCGTCAACGACCAGCCCGAGGACCTCCTCGTCTGCGGCGCCGTCGACTCGTACGA
CCGCGCCTACGACCGCGTCAACCCCAAGACGGCCCGCCGCCTCGAGCGCTTCAAGAACCG
CCAGTTCTTCAAGATCACCACCACCGACGACCCCATCATCCGCCGCCTCGCCGAGGAGGA
CAAGGCCACCGTCTTCGCCACCGACGCCATCCTCGCCGCCCTCATGTGCACGCCCCGCAG
CATCCTCTCCTGGGACATTGTCGTGCAGCGGGTCGGCAACAAGCTCTTCTTCGACAAGCG
CGAGGGCTCTCAGCTCGATCTGCTCACTGTCAACGAGACTGCGCAGGAGCAGCTCCCTGA
GAACAAGGATGACATCAACTCGGCGCCGGCTCTTGCTGTTGAGGCCACCTACATCAACCA
GAACTTCTCGCAGCAGGTGCTGGTACGTGATGGCGAGAAGGTTACCTTTGATGAGCCTAA
CCCGTTTGCCTCTGAGAATGAGGAGGCGGCGCCTGTTTGCTACCGTTATCGCCGCTGGAA
GCTGGATGATGATATTAGCATCATTGCTCGCTGTGAAGTGCATGCTGCTGGTGTTGATCC
GAGTGGTGCTCGCCAGTTCCTCACTCTTAATGCACTTAATGAGTTTGATCCTAAGATTAC
TGGTGTTGACTGGAAGCAGAAGCTCGAGTCCCAGCGCGGTGCCGTGCTTGCTACAGAGCT
CAAGAACAATGCCAACAAGCTCGCTCGCTGGACTGCCCAGGCTTTACTATCTGGCGCGGA
CATGATGAAGTTGGGTTATGTGTCTCGTGTGCACCCCCGCGACCACTTCAACCACTCCAT
ACTCACTGTCATGGGCTACAAGCCAAGAGATTTTGCTACCCAGATCAACCTCAACACTGC
AAACATGTGGGGAATTGTCAAGTCGATTGTGGACATATGCATGAAGTTTGAAGAGGGCAA
GTATGTGCTTGTGAAAGATCCTGCCAAGCCACAGATGAGGATCTATCAGGTTCCTAATGA
TGCGTTTGAGAACGATTATGTTGAAGAGCCACTTCCAGAGGAGGAGCAGGTTCGCCCGGC
TACAGATGATGTCGATGCTACTGCACAGGAGATGGATGCTGCTGCTGAGGCAGAGGCTAA
TAAAGCAACTACCCAGGGTGGTGACGGTGAGAAGACTGCAGATGCTGCCGCTGCTTGAAG
GGTATAATGGGTCATCTTGCTTTTATCTAGATAATGTGTCTTTTCTGTTTTATGATCTGT
TTTTGTGGATTAAAGAGTTGATCTGCCTTGTCTTGATACAGTGGTCTTATTTTGGTCCAT
GAGAAAACTTGTTACTCTTAAATTTTGTGCTTGGATGTGCTAAGCTTAGCACGCACTGCT
TTGGATTAATGACTATGCTGGTAGTTGAATATTTATTCTATGTGGTTGATCTGCTGTGTA
TGTTTTGTCCATTGTGTATGCACATCTGTTTTTTAAGCCTTGCCGCCAAATGCATCATGA
AAACCTTGTGGCACTTAGTAACTTGAGAGTACCCTGAGTTGTCTTGCAATTTCCATGCTG
TGCCGCAATGGCTAGGCTTGTTGCTGTTTGTTCTGTCTTTGTTGCAATTGTATATGGGTT
GAGAGCGCTTTTAAACCTGTATACCCAGTATCCACTTAGAACAACAATTGGAAAGTGGGC
AATTGGGTTGAGCTTGATAATCTCTTTCGCCAACAATCATTTTCCTCTCATTTCAAATGC
ATCTCATTGTTATTTTTATGCCTTTGGTATCTGCATGCTTTTCTTTTGATGAAAATTTAG
GAAACTATGTGATGCCTGGAAGCTTATTCTCCGCCTTAAGATTTCTGCGTCTTTTGAGCT
CTGCGTGCAGGACTAGCATGGTTTGTGCTAGTTAATATTTGATGGAGATGCATTTGCCTA
GAAAGCATTGTCTGATCGCTCACCATTGCACTCCAGAGCCATTTGTTCATCTATTAAAGC
ATGAGCATCAGGGCTGCATTGTACCAAGTCCTGTGTTCTTTGTACAATCCTCTTGCTTGC
CAGATTCGGCTGTAGTCAAAGTACCAGTGAAGGAAATCTGGTCGGCCTACCCATTGCTAA
TGGGCAACCAACTTACCATCTTTCCTACATCTCTTATCACCATTTTTTTTGTGTGTGAAT
TCTGCAAGAGGAGGGAATCAGTCATTCCATATTGTCAATTATGCATTTCTCAAGTTCTGG
ACATTGTGGTTTGTTGTAGTTGAGACTACCTCATTCCAGTGTACAAAGCATGCTTGCTTT
CACTAGGAACTGCAGGATTTTGTCTGGAGCATGCTGCAATTCTGTGTGCTTGTTTGTCAA
CCTGTCATTTGTTCATTCTTCTTGGGCAATTTTGCATCGGGTTTGAGCACGGTGAGAAAT
GATGTTTGATCCCGTTCGTCGTAACTGGCATCTTCTTTCCCTGCCGACCATTCTGTTATA
TTACGACCTGAGTCCAGGGAACGATCTAATCTTCTCTATGAGGCCAGTGATCTTGCTCGT
TTCTTAATCTGTTTGGCTACAGGAATGGTAAAGGCAACGTTAACATTGTTCTGTTTGGTT
CGTCCAGGGTAAAGATACCATTGCTCTGTTCGGAGCCGTCCTAAACATGCGCGCCGCGGA
CCGCGCCCTGTCTCCTTAGCATGCGTGCCGCCGTCTGTCCATGAATTGTACGCGCTGGCT
AGTCCCCGATCTGCACGCTGCCAGGCGGTCTCTTCTAACCCCTGAGAAAAGAAGAGCATC
AGTGAGAGTGGGCTTTGTTTGGGCTCCAGCTAGCTGATTCTCAGATTCTAGACCTTCTAA
ATTCAGAATCTCAAACAAACATATCAGATTCTTACATAGCTTGCAGAATCAGTTCTAGAA
AATGAACTACGACCCAAGCCAAACCGGAAGTTGCAAAAGAAAACGTTTCTTTTTCAGCCT
TTGCCCTTGCTTCTGTTGAGATTTAATTGACACATGTGTTAATTAAGAAAATCTTTATTA
TCCCTAACCACCATGCGTGAGGGCTGCGACTGTTTGCATCTGGTGGATGCATCCCCTTGG
AGCTATATGTATTTATACTCAATCATCAATAAAAGACAACGATTCACTTCACATCTTTTC
TATGGTCTTTCGTTTTACTTTGAATACGTTATCAGCACATAAAATCCGTCCTAAGCAATT
GGGAAACATCGCGTGGCCGTGGAGACGCTCGGCCACAACACCTCTTCTTCTGGTGCGGTA
ACGCAACGCCATTAAGTAACGGTGATGTTGGCGGCGGCAACATCCATTCGTATAGGATAT
TAACAACATCCATTCGTATAGGATATTAATCATCAGATGCTAACTTTGGTTGTCTTCTTG
ATCGGATCTGCCGAGCGGTGGTGCTGGTCCGGCCGCTCTCGGCTCTTGACTCGGCCCCTG
CTACCGCATGGACTGAAGGCCCCGTAGCGGCTATCTCTGCCGCTCATGCGCCGGCTGTTG
AATAAATCCTAGTGCATCTCTTGCTGCTAGATAGTTAGTTTCCTTTCTCTGAACTTTACT
GTAGCGTTTCAGGCTGTTGTCGCTGCTGGACTGCAGTCAGTTTAGATCCTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1290..2880, 4267..4272
1291..2877
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved