Hordeum_vulgare Locus HORVU1Hr1G077470
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU1Hr1G077470
Hordeum_vulgare
HORVU1Hr1G077470
chr1H
snoZ223, snoZ278, snoZ101, snosnR60_Z15, snoZ43
3093..3188, 3334..3449, 3848..3941, 5048..5145, 5239..5336
7889
ATATGGGGCGGATATGGGAGAGCCCGGGCGCGTCCGTCACGTCGGACCGACGGCTTGGC
CCCATGCGGACTCACCGGGAAACCGGACAGTCCGACGAGCGCCTCGACCGTCGGCGCGGT
GTGAACGCCTCATGGTGCCGCTTCGGCTCCTCGCCCAAGGTCGGGGCCGACTATTTAAGC
CGTCCGACGCCCCCAACCCTAGCACATCCGCTTCCTCCTTCTCTCCGCCGCCACCCGAGC
CCGTCCGCCTCATTTCACAGTTCCCTCTCCGTCAGGATGGTCCGACTGCTCATCATCACC
TACGCATCGCTCTGGGTCTCCCTTTGAACTCGCCGGAGACGAAGGAGGAGGAGGAGGAGG
ACGGTGAGTAGGGGCAGCAGCAGGAGGAGGAGCAGTCGGAGGCCCGTGGAGGAGGCTCAA
GGCAGAGGCGGAGTTCGTCGTTGCCCAATCGGAGGAGATGGTAGAGCAACAGGCCATCCT
AGATTCCACCCGGGATGAGGTCGAGGTGGAGGCCAACCGCCGGCTCATCCCATAGAGGCA
AGCGGAAGCCGACACCCTCTTCGACGAGCTGGACGCGGAGATTGAGGCGGAGGAGGCCGC
AACGGAGCAGCCGGAGGGATGGAGCTCCAGCAGGCAGCCATTTATCCGTCGAAGGGCACA
AAAATCGTCGACATTTCCGAAGAGGAGTAGATAGGTTGTACGTAGTACATAGGTTTCATT
TCTTACATACGTAGTACGTAGTGCATCCTGCCTGCCATCTTGACGGGATTAATCACGGGT
CCGGAGGTCGCAGCGCAGCACAGGTCAAGGTACGCCGCCGGAGCCCGGAAGCCAAATCTG
TTCTGGTTCGGGTTTGCCCCAAACCGACTTCAGCACGTGTTGGAGAGACCAGCTATTCCC
TACTTGTATGGGGTGACCTTTGCAAACTCCGCGGGTGTTCAGGTTTCATCCCGTCCCTAG
ATGTTGCATCTAACGGTGGAGCGCCCAGTCCTTCGGAGGCTCGGACACTTTCCCGAGACC
GACCGAGACGCACCCTCTGCTCACAAAAGATAAATAAATATCGACGCACGCGCACCGGTC
GTCCGCGGTCCGCTCACACATATCTCCTCTTCCTCGCGATCCAGCAGGACTCGGGCGGCG
CCGGCGGCGACGGATCTCGGCGAGATCGGAGATGTCTTACCTGCTCCCGCACCTTCACTC
GGGCTGGGCGGTGGACCAGGCCATCCTCGCCGAGGAGGAGCGGCTGGTCATGATCCGGTT
CGGCCACGACTGGGACGAGACGTGCATGCAGGTACGCTACCCACCCCCAACCAAACCCTA
GTTCACCGGATTCGTATCAGAAATTCGGCCTGGGTTCCTTGAAATCGGGCGAGGGTTCGC
CGTAGAGATGGCGCACGTAGACCGTGCTAGGTTTAGGTTTCATAGCCTCCGGGGATAGTT
GGTCAATTTGGAGTAGGGTACAAGTGGAGGGGGATCTTTGGATGTCTCCTATTGTTGAAT
AAAAATCTTCTATGTGTGCCGACAGCTGGTTGCTTGACGAGGTTGAAGGAGAAGTAGAAG
TAGCCATTATAGTCGGAGGGAATTAGGGAAGGGGCGCTTTTCTTCTTTTATCCACGGCCA
ACTGGCTCATTACCTTGTGCGAAGGGTTGAATTTCTTTTCGGTTTTATATTATATTGATT
GATTGCAGGCTTGCGGTCTAGCTTCGTATTATCCTTTTGTTCTACATCAGTCTAGCATTG
TTGTATCTTGTTCGACTTCATTGCGAGTTTCTGACTGTCCACCTGTTCATGTTCAGATGG
ACGAGGTGCTGTCAGGGGTGGCTGAGACGATAAAGAACTTTGCGGTGATCTACCTTGTCG
ACATCACCGAGGTCCCCGACTTCAACACCATGTACGAGCTGTACGACCCGTCGACGGTCA
TGTTCTTCTTCCGCAACAAGCACATCATGATTGATCTCGGGACAGGAAACAACAACAAGA
TCAACTGGGCAATGAAAGACAAGCAAGAGTTTGTTGACATCGTGGAGACTGTCTACAGGG
GAGCTCGTAAGGGCCGTGGTCTGGTGATTGCTCCCAAGGATTACTCCACCAAATACCGTT
ACTGAGGTATCTGTGCCTGGCTATATGGCCTACTGTGAAATGCCTGTTCTCATAAACCTA
TAACTCAGGCTGTGACCCTTTATGTAATGTTTCTCAACTTTGAAAGTGCCGTGCAACTTG
TATTTGTATCTTGAATATCGACGTGTCATAAACCTGTAACCCTTTGAAACATGACCTACT
GTCTATTGGTATGACTGGGAAAACAGACCTTTGGTTTGAACTATGTGTGTGAATTGCTGA
ACTTGAATTGTCATGTTGGTGGAATGTTACTGCTATTCGAGTATCCCCCTATGTTGCTGA
AGCAGGTTCATTTTCAGGAGTTGTGGGTACAAGTTATCTGATAAACGGTGTTTCTTTGCA
GAGTCGACTATGTTGTTCTAACAAGCATGGATAGAGATGACATACCTGATGGTGCAAGTT
TCCATTTTGCTGAGACAGTAAGAGCTCTAAATTTTTGTCCCTGACGCCTTAGTGTGGTAA
TTGAGTTGGTGATGAATCTACCATGTGAAAGTGTTGGGGCTTCTTTTCAGGAGTTGGAGC
CTACGATATTGGTGGAGTGTCTAACTTCCGTTTTTCGAGGCAACTTGGAGGCAGTTGCAA
CCTTTTCAAACTCTGGTCTAGATGTGTATGCACAATAGTTAGAGATCCCTGAGCAGGGTA
ATTGCTTCGTTGATTATTTTTTGCAGTCTATTAGGGAATCTAAATGCTATATCATCTAAA
AAGGAAAACCCATTCCTGTTAAAAGGGCTTTATGTTTTTCAACACAAGTGAGAACCGAAT
ATGGGTAATTAGTAACCTATATCACTCATACTTTTTTTTAAACCTTATGTTTGACTGATT
GCATGGTCAAAGAACATCTAAGGGACTGAGTTGTCATTATATTTTAGATCTTTGCTGCCA
ATAGTTTACATATTCTGTGTTTGTTTTGATCTGCTTCTCATAACGGTATTCTTGCCTGTA
AAGTGTAAACTAATCTGTGTGTTTTTTGTCTTGATATGGCGGTGATGGTAAACACTTTCA
GCAAACATGCCAGTTCTGCTTCTGAGAATTCATGACTGAAAAATCTGTTATATTGATCTG
AGCCACTGCAATTGATAAAAGCTGTGTGCCTGTGTCATCCCAGTGGTAATACCCGGAAAA
TCATGATAAATGTAGCTGTTAAACCTTTGTATCTTCCATGTGTTTGTGATCTAAATTAGG
AGCTTGTAATTTGTTCTGAAACATTGTCTGAAATACCAATGATGCTAAGCCCAACGTTTA
GAGGCGCATATGGCTCCAGGATCCTGTTTACAGGATGAACCTGCCTGGAGGCGCTGTATC
CACATGACATCCATGGGCAAGTCTGAGGTTCTTGATGATCACATGAAAGTTATCTTGCTG
TTTTCAAGTTGGCTTCTGTTTTTCTAACTGATAAAACTAACTATTTGTTTAACATCTTTG
TTGAGATTAAGTACCCTCTCACAAGGATCTCTGATTTGTGGAAGAGGCTGGATTCACCAC
CTTACCTCCGAGTAATGGATTTTGTTTTTTACTCCCTCCGTCCCATAATATAAGAGCGTT
TTTGACACTACACTAGTATAAAAAACGCTCTTATGTTGTGGGACGGAGGGAGTAGCTTCT
GCTGTTGAAATATTGGAATTCTTCTTTGCAAACGAGTCTGAATTGTTTCTTGCTTTCTTA
TTCTTTTCTTGATGTTCTTTCGAAAACTAGGTTTTTCAAGTTGTTTGCTGTTTCTGGTAG
GAGCATTATTGCTGCAAATGAGACGAGTTTTATAGGTAATTTGCGCCTGAGCTGTTTCTC
TGATGTCACACCCTTTTCACCTTGGAGATCTTATGCATCTTTGATAAAGTTCGCTTATGT
TGGGTTCTTCCTTTGTGTTTCTTTTATTTCTGATGTCTAGATGGATATTCGGTTATACTT
GTCCCCAAATTCCAGTTTAACCTCTGCGCTTCTATTGTTTGTGATGCTTTTTTTATCTAG
TTTGGTGGTGCGGTGATTATAAAACATTCCTCGTTCTTATTCGCCCTGAGATTGTTTTGT
GCTTGGATTCCTAACTAAATGTTTATCAGAATTCTGTTGAACTTCAGATTTGTCATCTTT
GGAGCTAATATTTAACTGACCCGAGTTATGTTATCCTGGCCCAAAGACTACAATGTCGTG
TTCACAATTGGTGCTTGTTTATCTGAATTTATTCTTGGTGCTGGTGGTTGCAATTGTGCA
GGGATTATAAAACATTCCTCGTGCTGATGGCATATCCTTGGAATGACTCCTATACGCCCA
TAGAATCTAAGAACCAATAAATCATTTGACGTCCAATTTGCTATTCTGATTTCATCTTAT
TTCTTGGTTGTTCCCATTCCACTGATTCGCTGGGAGCATTTTTGTTGTATTCATAACTCT
TAACAGCAATTAATCTCCATGATGATTCATATGTCTAAAAGGAATGGCGCAGGTTGATTT
TGGTGTAAACATGCATTTCCTCCCCTCCCAGCAGATCTCACTCTTTTCTGTCCCATTCTG
TGATTTCTCATTTGGTTTTGAGGACGGTGACGATTGATATCTGTCCTTGGTCGTTGTAAC
TGGCATCTTCTTTTCTTTCCAACAATTCTGTTATATATCACCAGCATATTCCGATTCCTT
AGTCTTTTTGTTTGTCTGTGCCGAGGGTTAAACTAAACTATAGAAAGCATATGTCTGAAT
TCTCTTCATGTGGAATGTTCTAATATTCTCTATGAGGCCAATCTTTTTCATTTGTTTATC
TGCAGTTTTATTTGCTGTGTTTTGTTGTTGTGTGATGCCGATGATGATTAGTGTGAACCT
TTCTCAGTGAAATCACTAATGATTACATTCAGCTACTGTCTTCCTTCACATGCATCATGA
TTCCTGGAATTCTTCTTTTTTTTCTTCTGTTAATTCGTTTTGGTTTGCCTGTTGATTTAG
TGGTTTGCCCAGGTTGAATGAGGATTACAAGTGCATAGTTCATATGATCAAATCGTGATT
ACTTGAAAAAAAAAATAGTCTTTTCGCTCCTATCTGATGACTTTTCATCCTCACCCTTTT
CAGGAGAATCAAACAATAGTTTTTTTCTTTTTGCATTTACACCTACGTTAATATGGTTTA
GATGTATGGATTCCTTAGAGGACGGTGAAGTTTGATATTTTGGTCTTGTTCGTCGGAACG
GGCATTTATTTGCCTTGCCGACCATCCTGCTATATCACCACCCATATGTTGATGCTGATA
TAGACTTTTCATGCTGATTTGTGTGGGAACCGTGACAAATCTCACGAGTTATTATCGGTT
CACCCTCATGTTTTTTTTTGAGGTAGTAACCTCTGGTAAGGATTAGTTGCAGTATGCGTT
ATACAGACATCTGAGCTGGTCTTTTGGAATCTCGGTGCAGCACAGGTACTTGGCCGATTA
GAATCATGGGAACAGATGGTCTTAGAACTTGGCAGTTGTGCTGCTCCCAGGTACTATCCA
TGCAAGCACCTTTTTATTGTCATAGGTTCATAGCCTGAGAGGATAGTTGGCTAGTTTGGA
TCTGTAGAATAAGTGGAGGAATTCCGGATGTCTCCTTATTTTTGAAATAAAGTTTCTAAC
TTATACTGAGCTAATACTCACATTCTGTATTTTCCTGACTCTGAGATATTTGGAGTAGTT
GAAGCTGGTTCGTTGGTTAAGTTGAAGTAGAACTAGCCATTGCATAATGATATCATGCAC
CTCGCCACATAATTCTGAGGAAATCGAATGATTTGTGTTTTTTTTTTTCATTCAGCAACT
TCTTTCGTTGGGTTGTGCAAAACAATCTTTCTCTGAGGTCCTTTTATAAATGTTATTGAT
TGCAGTTTGATCTAAATCAATCCTTCTGTTTATCAGGCTTTTTGGTTTTAAATCAATCAA
GTAAGTCTGGATATCAGTGGTTATGTTGCATGTGGTTTGCTATTGCTGCTCATGGATAAT
TCCTTGTGCTACCCTTCTGGGGGAAACCTCTTCTGATGTGTGCTTTTTTTTCATGACTAA
CTTTTATTGCTTTGTGCAAAGGATTACATATCTTAGCTGTTTTATGTTATTGATTGCAGT
AATTGTTTTTACTAGGCTTTGGTTCTACACCAATCTAGCATGGTTGTATGTTGTTGACCT
CATTAGGAGCTTCTGACTATCTACCTGTTCATGTTTAGATGGATGAGGTGCTGTCAGGGG
TGGCTGATACCATAAAGAACTTTGCGGTGATCTACCTTGTTGACACCACGGAGGTTTCCG
ACTTCAACACCATGTACGAGCTGTACGACCCGTCGAAGGTGATGTTCTTCTTCCGCAACA
AGCACATCAATAAGGGGCGTGGTCTGGTGATTGTTCCCAAGGATTACTCCACCAAATACC
GTTACTGAGGTATCTGTGCCTGGCCATTCATGCGCAGTGTGCGGTCTTTTCTGTTCTGTG
AAATGCCAGTACTGACGCTGTGACCCTTGATGTAAATATCTGTCAACTTTGAAAGTGTCG
CGTAACTATGTATTTGTATCTTGAGAGGTAAAGTTCATATTCATCGAATTGCTGGACAGA
GATTGGTAAAATTTTAATGCTCTCCTTGTATCTACCCATGTTGTGGCTGAGCCGCTGAAG
CAGGTTCATATTCATCGAATTGGTGGACAGAGATTGGTAAAATTTTAATGCTCTCCTTGT
ATCTACCCATGTTGTGGCTGAGCCGCTGAAGCAGGTTCATATTCAGTGAATGAAAATCCC
AGGCATTGAACATTTTCTTTCTTTTTTTGGATGGTGGGTGATGAACTCCCAGAGTCTCAC
TCGTGGTTTATAAATTCCCACTATTCTTGTGTGTTTATTATGCCATACCACTATTCTTGT
GTGTTTATTATGCCATACTTGTTTATACGTAAAGTCCCTCCTGATTCAGCTTAGTTGGTC
CACCGTAGTGATGTGATGTTATATGACTGCAGACCAAGTCCTCGACCGATTTAATCATTT
GAACAAGTTCCACCTGATTCAGGTAATCAGGTGTTCAAAAGTTGTATGTCACTGGTGGTA
TATATATAGATAATGAAGAAAGAAGAATCAGTGATCTGTATGGTCAGGAGATAATTTTTG
TGATGTGTGTGTTTTTTCTTTCGAGGGAATTCGGTTGTGTGGTTTGTACTTGTACGGATC
GTTGTGTCAAAAATCTCATCCGGTTGTTCATCAGGAAACTTAACTAGATGTGAACCGGCA
AGATACAAAACATCCCTTGAATTTTTGCAACATATCCGTTATTTGCAATGGTCTTTGTTG
CTAATAGAAGGATGTTTGTTTCGCTTGCAGAACACCAATTGGGGTGGTGGCGCAGTTGGC
TAGCGCGTAGGTCTCATAGCTTATACAATATGCGAGTGATCCTGAGGTCGAGAGTTCGAG
CCTCTCTCACCCCACAAAACCAATGACCTTGTGATGATGAACCGCTCTCTGACAACTTGG
GTCGTCAGATTTCCACCTGATCCTTCAGGTGTGACTCGAGCAACACTGAACATGGTCACA
ACTTTTTCATTTTTTTTCACCCAAGCTACTACACTTGGTGTTAATCATCTCGTCTCGTCT
TGTTTCTGACATGTAGTTGGTTTACTGACTCTGAACTTGGCTGGGGGAGTTCTAATGATG
AAACTATAAATCACTCAGATGACTTGAGCAAGGCCTCGTTTTTTTTCACAACAATATTTG
AACCATGTGATGCGCTTTTTTTTTCTAGATGATGCGAAACACGACTTATATTGATGGGTT
CGCAACGAAATCACTTTATGTTGCCATCAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1290, 1796..2105, 2461..2536, 2630..6841
1171..1290, 1796..2104
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved