Hordeum_vulgare Locus HORVU1Hr1G055440
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare HORVU1Hr1G055440
Hordeum_vulgare
HORVU1Hr1G055440
chr1H
snoR11, snoZ152, SNORD14
4365..4465, 4532..4625, 5150..5271
6764
acccaagcaagggagacaaagataatggatggagtaagaagaagaaaagtgagttaaac
gtgaacaaaaatccgtaatgctatctgacatgcacaaggatcctaagggtacatatttga
catgttcgataatactgcaccattagaatatctatgccttcgagttcgattctcacgcct
tgcattcttccgttgcaacgcacggctcttttgttagtcaggctaatgcaattccatatt
ttgggccaaaatctgaaagcctcaaaatcatggatcctgttctacggcccgagccttgcc
ctctctcatatccgcgggtgcaatcatttctcgtcttaggttctccaaacttggttatgt
aaattgtgaagatactgtaaaaaaaagcgagaagtatgtaaaatattcacaagaaaaagg
gtcacgtgaggaacatttcagttgcatcctctagagtctgtaatttcatgacataaagga
caggataggaccaagcaattcccgttccacgctcggtggagagggtgagctttccacaat
tgttggttgaactaagcacttccatctaattcaacaataaaagatccttccaaacagatt
ttcgtcctagtgatcccacagttgactaatgaataaaaatcccaaaatcatgtttgttgc
agccaaaagctcagtcgtggcaacggccaccactctccgtggaggctgacaagactgcac
ctgatgagatgcttcttgcggcctcatggaaatgaaaggaaagggaggtttgtgcagcgg
ctagttatgcttcagtcaatgcaaggaaaggaaagggaggtagtgataaatttcttaatc
ggccaattaatagattacgaaaaaagtattttcctgaattgaaatatcacaaagaagttt
ccttctgtaaatagagtagaagatacgccaatcttctgcgtgttctaaaaacagaaagag
cattgcaatttttgtacagtatacgtatattgctagaagaaAAGCAGGCAAGTAGGGGAG
GATCGTGTTGGTGCCCCGCGGCCAAACGTTCGGGGAAGAACCAACCATGGCGCACCGACC
AGGTCGCTGCCGCAACAAAACCGACGCGTAAACGAGTGGAAAAGTCCCGGTTTTTCGCCG
TCACGGCGAGGGCCCGACCCTGCCTGCCTTCATCCCCCGGCCGCGCCGTTCGTTAAAACC
CGCGTCTTTGACTCGCTCCGTCTCCCGTCCCGTGGCATCCGGCTCCCTTGAGTCCAAACC
CAGCAACCGGAGCGGCGAATCTCGGCAGGCAGGCACCACCGCCCAGCAAGCAGCCGCCGT
CGAGGCGAGAGATGACTGCCGGCGCCGCGAGCGCGGGCGCGGTCCGGCGGGCGGTCGACA
GGGCGTGCGCGGCCGCCAGGGGGGCGNGCGGCCGTCGGCGTTCTGCTCGGCGGCGGACGC
GGAGGCCGCGGCGGTGCGCGGGGTCCGCAACGCGCGCACGTTCCGGTACCACTACGCCGC
GCTGCAGTGGGCGCTCCTCCTGGCGTCGCTGGCCGCGGCGGGGCACCGGGCGTCGGTGCT
CTTCCTCATGGCCGCCTCCAAGGTCCTCCTCGTCTGCCTCGGCCTCCTCGCGCCGTTCCC
GAGATTGGCGCTACTCCGCCGATTCGTCGCCGCGGCCTTCGTCGCGCTCGTGCTCGCCGA
CCTCACCGCGGCCGGCGCCGTCGCCAACCTCATGGCCGCGCTGGCGGTGGGCGTCCCGGT
AATCCTGCTCCACGCCTCGTTCCGTGTCCGCGACGACCTCGAGGGGCCCTCCACGGAGAA
CGGCGAGGAGGAGGAGGCGGCGGTCGTGGAGAAGAGGGATGACGGCGATGTCGAGGCAGG
CCCCACGCGGCGGTCCACGGCGGTCGCGCCAAGATCGCCGAAGTGACGGACGGTGCGAGC
TAGGCGGCTGGCTGATCGACCAGACGATTCAGAGTCTTGGTCAAAACTATCTTAAGCTCT
TGACTGCTTTTTGATAGATCAATCATACAGTACTACTCATTGGTATTTTTGCTGAAGTTC
CGAATCGAATCGGTTAATACTCTTATAACAACTAGACGGTGAATGAGGATTATGGAAACC
CGATGTGAATGCATCCATTTCCTTACTACCTGTTGGACTAATCTTTGATCATACATACAC
TTAGCAGAAAGGAATGGAATACGTGATCAAAACTGGCAGTCGGATTTACTGTGACAATAT
ACATTTTGAGCATTTTTGTCAGGTGCATCGATCTGAATGTGAGCTTGCGTTCTTCTGGGT
CGCAGCGACGGGTGAACGGCTCTGTTCGCACCAGTCCTGCAATCATGTAGGCGTAAACAA
CCAATCTCTCTATAAAATTATCTAATCTAGCATAGGGATTCCCCAGAAGTTTTCTTTTCC
TTCTTCTTCTTTGTGACCGTTTCCACCACAATGTGCCACGATTGTGATTGCGTGCTTGTT
TGCATTTGCTTGTTTCAAACACAAGTTTCTGATTTTATACAGACATATTAATTTTTGGGC
CTGCGATGCAAACAGATATTACACCACACATATCAACCGACATGGAACCACACACTAATA
TCTATTTGACCCGATATGTCCACGGGAATAAACTATGCCTAAGCGACACAAATGTGGTAA
AGAAATTGAACATAAGAGTATGTATTTACAAATTCATCATATTATATAAACCAAGAACAG
TATTTTCTAAATAACACAATAATGCAATTTTTGTCTTAGAGTAAATACCTTGTAAATACT
TATCAAATAATTAGTAAATATCCCCGCAAAAAAATAACTAGTAAATAAAAATGGAATTTT
ACATTTGTTATGCTGAAGCATTGATGCCATACTACTTTTAGTAATAAAATTATATATGTT
GTAACTAAGAGTACTGAAAAAAATCAGATATATTTCTCTGACACCTAAGTATGCTCCAAT
ATATCATCCGATATCTTATAATCCATGTGCCAAAGCCATTCAAACATTGTTTCCAAATAT
TTTTAAAATACTAGTACTCAAATTTGACCGGGGAATACATTCTTTAAATTTTTAGAATAT
TTTTCGGGGATTTAGCGTAAATTGTTTCAAGGGATAGCCGAAATTATTTCCCTGAGTGGA
AGTTTTTCTTTCATCTTTTTGAGGGGTAGTATTTTTTTCATTTAGGGCCTTGACAGAGAG
CTGGTCCTATTCAGCCCACAAAAGCCTTTGTTTCATTCTTGTTCGCGGCAATAAGGCCCA
GGCCCGTAGCACGGTACGACACCATCGAGAGACACGTGCGCGGTGGTCGGGCCGGGTGCT
ATATATTCGGTCGAGCCCCTCGCTAGGGTTTCCCTCATCCTCCCTCGCCGTCCAAACCCA
ATCAGAAATCTCAAGCTTAGCGCAGCAGCAAAACAATGGCGGAGCAGACCTTCATCATGA
TCAAGCCCGACGGCGTCCAGAGGGGCCTCgtaagcgccgcctcctcttctcttctctccc
cgtcggctcgtttgctccgctgctagctcgtgctgacatctgcctgctcctgttttttct
tctgctttgctcagATCGGCGAGGTCATCAGCCGCTTCGAGAAGAAGGGCTTCTACCTTA
AAGgtaaccagcacaccgctcgcgttcgtgcttgaattggggtttgggtgatgatttgct
tgctgatctgcgagctggctgtgcagGCATGAAGCTCCAGAACGTGGAGAAGTCGTTCGC
CGAGCAGCACTACGCCGATCTGTCCTCCAAACCCTTCTTCGCTGGGCTCGTGGAGTACAT
CGTCTCCGGCCCGGTCGTCGCTATGGTCTGGGAGGGCAAGAGCGTCGTCGCCACTGGACG
CAAGATCATTGGCGCCACCAACCCCCTGGCCTCCGAGCCCGGCACCATCCGTGGTGACTT
CGCCGTCGACATCGGCAGgtgagattttaccctggagttgccagtgcctcggtgctattc
agttgaatcatgtataacttatcctgtctgcatgttactgttcccgtataatccaatttg
aaaattcgcacacttgcatgtatggagatagtcctacataacgcttgtttttcagccgta
tgctaatttagctaattgtcttagttagaagataagatcgtgttgcccactacttggttc
agccaaattaaatatctgatgtcgtctgagctgtttagcctgttgaggaagttcttatct
tgcttagtgaaacaaagttatactgcatgctgtttacaaataattctccggttcataaaa
tcttgcgttattacctgatttggatgcgtgtaggacagcacttacggtcaatggttgttt
gatgtgtgtacttcagtcattcatgtatgatttgtagtagaggattggcttatgatgatt
caggtccgaaaggatcttagcggatttctgtgaggcagattcgtctgtcattgatcgatt
catgttgttacacacactgaagcctttccgttttctgtttcattgatttgttcttggttt
tcattctcatttttattgttgttgtgagatgtgatgcgatgatgattcatataggttttt
ggcagtagtggcattgtcgctgtgagccttcaaaccaaaaacgacttctctttccactga
gcattgccttgttccacccagtcctcccagttacgtattctgggatggttttattgcttt
tgtttctttaatgcatcttgtctcagtgaagagctctagaccataggaagtgccgtatga
cactgtaaacagcagctgcttctctgcctgctgcaagtgcccattctcttataataacct
ctgtggttttatctggatggaattacccatttgtaccagcttgattcagctgtgtgcttg
attttaaacgggtctctgagggatttctttgatgctttatgttagctagattatattgtc
aactttttgttaattttgctttggcccgatgccacgtctccattagcgactagccttgac
tggagatgctacattgtgccgagagagagtttttggacgtttcacatttgataggaacct
gtggctgtgattctgtcggcacacagagccgttttttgtgattacacttcttgattgcat
agccataacgtaatattcattgtagtagttttgaaattggggaactcaaatggcgatgat
gataaaactaaggcttgtttctcaaaacattcgcagttgccgcctaagagctttcgccct
gccaggcttgacagctaatgctgctaattccttccttggatgtctgagccatgttgattt
tcatatttcattttttttatctcagaaaaataatacaatgtgcaaagaagtgtgcagaaa
ggcagtgtgtggaaagcagcctttttcagttattatttcactcagtgcactaatcctgtg
atttatcggtggcccggaacacccatttttccgcttttcttgcatacatatacatatatt
gttctatctggatgcattctgaaacttcttatctacgccatccagGAATGTCATCCATGG
AAGCGACTCAGTTGAGAATGCCAGGAAGGAGATCGCCCTCTGGTTCCCTGAGGGCCTTGC
TGAGTGGAGGAGCAGCCAGCACAACTGGATCTATGAGGCTTAAGATGTGTCATCAGTCGT
TGAGGGCAGGATTCGCGAGCATCTACCAAACTAGTCTTGGCTGTTTACAGTTTTGAGATT
TGTATTTCGGGAACCTTGTTTGTGTGAACTGAAGTTATCTCTTTGTGCTTGCACATGCAA
GCGGTatctgctgctctatattttatatatggtattgctttgatatgaggttgcatttca
tgcttttgctgtgtattggttgatattttgtgatacttttcctttgctggacagtaccag
aatgccaaatcgtgatctttacagcaaattggtacgcttaatatttgttggagaacacta
tgattccgcctctccgtttcacgctcatagccatggctgatgttcacgcgcgcaactagg
agtttcagcaacttggtatctgtttcaaaaaattggaataaatattttttgttgtaaaag
ttttctgtaacatcacttttgttgcaataggttctgcaacacgatccttgttgcagaaaa
tattttataacaagttgtatcgcaaaaaggttttaactccgccggacacgtagacgtcta
gcagtttctatatttgtttatgtatcgaaatatatgtcgttgaagtagctaactttaaaa
tcgttgatataagttttctaagattaaatacaggactggaggaacatgttcttctctaaa
aagctttggctcatcgtgctggctaagtatctgcactccaccctggcgtgaagcaaggta
atagtatctactccctcttggctcatcgtgctggctaacgacctgtttggatcctctccg
ctcccaaatgcggcttccggagcggagggagcgccatcgtaattttagggagttggtaaa
accgggctcttcctttcctctaggacgtggagcggagttttgaatgagagagatcccgaa
caggctctaagtatccgcaccccaccccggcgtgaagcagggcaatagtatctactccct
ctgatcgtaaatatttttttagagattatatatagacatatttagaagtgtagattcact
cattttaattagtatgtagttttttattcttattgagatgtctaaaaagacttacgttgg
cagttttctttctgaaaatagtttaattggtatggggagcaacct
  Untranslated Region
  Coding Sequence
  snoRNA
1001..3448, 3554..3602, 3686..3917, 5505..5764
3395..3448, 3554..3602, 3686..3917, 5505..5622
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved