Homo_sapiens Locus mono:SNORD46.1-201
snOPY snoRNA Orthological Gene Database
Homo_sapiens mono:SNORD46.1-201
Homo_sapiens
mono:SNORD46.1-201
7
SNORD46.1-201
1001..1104
2104
gaaaactaattttctcaccatcagtgtatctttaaaatcactggtcaaggaataataat
ccttttatattggtaaaatttgttttaattattcatacatttcagggtgaaaacattatt
cttctaatttcaacccttgggcccaaatatagttcccctgagaatgagtcatctatgaca
ttataggtgatgaatggataacagaaatttgcccccttccctctccaatcatggggcagc
tgaactacagaacttatcttcctggaagaaggcattttcccaagtggaatacaagttatg
ggggaatgaggggagtcttcaggttcatggatgtaacattttccatgctgtgttcttcct
cactcgtaaaagtttgatttttagcatttggcattaaaaaaatcaatcctgcctaatgat
acccctcattcctaatctttctttcctttctttggtgaaaatctttgtggagtatcagtt
cacatttttcattagcatttcttctgggtttccttagattttacaagtggttaagcaatt
agcatacttcttaaacctttaagcaaataaatgcttagaataacacaatgtgtagtcact
accacagtgacaatgaagccaactatattattttcatcggctcatgggaagtgtgtacaa
tcagtgtctacaatgagcatgtgaaaacttagagcttacattttacaatatgaaaagcac
cttccaaacatttgctcattgtaccataatcttctcaagattggctacaccgagcaactc
aaacaggtctgtgtctcagtcatattatggccttagtccttaccaatgcctggtacctca
caaatgtcttctcgactttgtgaagggaatggtggctttccgtgaactattcagcagaga
ttcaaacttagaggttacaaagtagctggtaagtgtcagagtgagacacaatgccaaggc
tgtggctactggcagatcatgaccttgctttgaaaagggggTGCTGGAGTGATGAAAAAG
TATCTTCAGGTGTGGCTGTGGCCACCTTGGCCACCTGTGTGTCACTTGCCAATGCAAGGA
CTTGTCATAGTTACACTGACTGTTAaaaagaaacaaaggaacaaaaagggaggcggggtc
aattctgggagctcttttggggtaggaacagtaggaaaaatagaaaatgtggttgcttta
aaaaaaaaattctgtgccattgtggtttctccatggaggctctttaatttgtatgtatta
attgtgtaatataatcctccttgtggaaccccgtatctttttttaatttttttggagaca
gggtcttacctgtcacccaagctggaatgcagtggggtgatcccggctcgctgccacctt
gacttcctgggttcaagctatcctcctacctcaaccccccaagtagctggaactacaggc
acatgtcaccacccctggctaatttttgtattttttgtccagacagggttttgccacatt
gcccaggctggtctcaaactcctgagcccaagtaatctgccaacctcagcctcccaaaga
gggaaccccatatcttctttttagctatatattttataaatgtctagagtgtacaacttt
cctgtgtatttttaaagtttgatgatatgagggtcattacctatggtaaatggcctattt
tggtacctcctgtgcagttttataattctgctgattatgatagcatcttatgttgagtca
accacaataaagatagttgcagggggaaaaagagagtcacaaggagtttaagtgttccag
ttggggaatctttgggatcatctacaagatagagcatagtaccatgagaagatgaagaca
gagccacctcagagccagcctcagcactgtggattcctaatgctgccacctttttgttgt
tgctgtgggcattaagtaaaagagtgtgatggtggatttcatgtgtcaacctgcctaggc
tatggtgcccagccgtttggtcaaacaccactctgaatgttgctgtgaatttttatgatt
tttaaataattttctagatgtgattaaatttaattcagtagactttgaccaaaaacagat
ttccc
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved