Homo_sapiens Locus mono:SNORA47test
snOPY snoRNA Orthological Gene Database
Homo_sapiens mono:SNORA47test
Homo_sapiens
mono:SNORA47test
5
SNORA47
1001..1138
2138
TCAAGGAAGACCAGCCTGGGCAACAGAGACCCTGTCTCTACAAAAAATACAAAAATTAG
CCAAGCATGGTGGCATGCACCTGTAGTCCCAGCTACTTTGGAGGCTGAGGTGGGAGGATC
ACTTCTTGAGCCTGGGAAGCAGAGGTTGCAGTGAGCCATGATTGTGCCACTGCACTCCAG
CCTGGGTGACAGAGCAAGACCCTGTCTTAAAAAAAATTAAAAAAAAAAAAAAAAGAAAGA
AAGAAAAGAAATGGCCAGAATGCTTTCCTAAAATCCATCCCATCTTCACTAGTAATTGAG
GAGTGTGCCTTTTCTCTACCTCCCTTGTAACTTTGGCTGTTAGACCTCTTAATGTTTCTT
GGTGTGATGGATGTAAAACGATACCTTATTGCTACTTTAATAGCATTTCCCTGAATATAA
GTGATGTTGTGCACCTTTTCATAAATTTCCTGGCCAGTGGAGCTGTTAGGTCATTTGCCT
ACTCATATTTCTCGTCTGTTTTTCTGTCGGTCTTTTTGTCTTTTTATTGTGTTTGAAGAG
CTCTTTGTGTGTTACGGTTGTGGCTGAAGTGTCTGAAGAGGTTTCTCCCCCTCCACATTG
CAGGGGCAGCTGAAATGCACTCGAGTTTTTTGTTTTTTGTTTATACTTTAAGTTCTAGGG
TACATGTGCACAACGTGCAGGTTTGTTACATATGTATACATGTGCCATGTTGGTGTGCTG
CACCCGTTAACTCGTCATTTACATTAGGTATATCTCCTAATGCTATCCCTCCCACGCCAC
CCCACGACAGGCCCCTGTGTGTGATGTTCCCCACCCTGTGTCCACGTGTTCTCATTGCTC
AATTCCCACCTATGAATGAGAACATGCGGTGTTTGGTTTTCTGTCCTTGTGATAGTTTGC
TCAGCTAACCAGGCTGTTACGGCCTGTGGCCATAGACTGCTGGTCACTCAGCAGATACTG
AGACTGAGGATTGTATTGAGCTAGAATATAGCCGCATGATGTGGAGGACTGAGAAGGTGA
GGCAGTTTTGCCCCGTGCTGCCTTCCACCGGTTAAGACCTCCAAAATCGAAGGGCTGCCC
AGGCAGAGGATGTCCCCTTGCCACCCTTGGAGGGGCAGCGCTGTGCTGGCCGACATTTGT
GATGCAGCCTGTCCCTGGCTCAGGTGAGGCTTCCACTAGGTCAAAAGGATTAAGACATCG
AAGTCAGTGCTTCTCATCCTTGTGCCCACTTTAACTCCTAACAGATGGCATTCACCTGTG
CGACACTCCCTCTGGGCATTCCAGTTTTTAAGGAAACCCAGAGAGGTAAAAAGCATGACA
GTAATCAGTCACCTCTGGCACTATCAGGGGCACATCAGTAAGGATGACTCTCAGACTTTG
GCACAAGTAAGAGAATCTGCGGGTTTATGTGCAGTTTCCAAGCTTTGGCTCAAGAAAGCA
TATCAGAATGCAAAGCAATACTCTTGATGTTATAGGAAACGTTTACATCCCTTTTAATTT
ATAAAGTAAATTAGTCGTAAAGATTCATTATAATAGTCTCTGCACTTTTGTGTTTGTCCA
GTAATAAAAAAGGACCTCAGGAAAGATCAGATTCAATATAGAAGGAAATAGAAATTTTAA
AAAAGAAAAAAGTATAGGAAAAATTTTAGGTAAAGTTAGATAATTAAAAATGTTTATAAC
ACTTAAATCTTACTCTGTTTAGCAACCATAATGTTATATAACCATAATATTTACTGGCCA
TAAAAACACTATTCTTGAAGGTGGTCTGTAACTCCTCATCCTACTTTCCCCCACTTTTGA
GACTTTAGCAATGTAATACATCTCTTGGGGGAAAATGTAGCCTTTAATTTCTAAAGATTT
TCTATGCTAATTGGTCTTTATCATGAGTGACCATATTTAAATCAATGCCTGTGTATCAGA
AGACATGTAAATAGCCATTTCTTTGTTAGAAGACGCATGGTACTTGTCTTTTTTGATGAT
TCTGGTATATTTGTTATCTTTTTAAAAAAATGATATGTTAAATGTCATACCTGATCCGGA
GTGGACTTGCTTGGTGGGAAAAAGAATACTTAGGTTTAGAAAAGTACAGTGCATCTGCAA
CAAGACTATTAGCAACTGAATTCATAGTTTACACTAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved