Homo_sapiens Locus SNRPN partial-2
snOPY snoRNA Orthological Gene Database
Homo_sapiens SNRPN partial-2
Homo_sapiens
SNRPN partial-2
15
SNORD109A
1001..1067
2067
ATAATTTTTTTATAATTTTTTTATATATTTTTTATAATATTTTATAATTTTTTTTGCTA
TGTGAGTATCCCTACTTTGTTCAAGGAATCTCATTATCTTTTCCCTTTTTTTAAAAAGGG
ATTTTTTTGTAGTAACCTGAATAAATTGGGGGAAGTATTGATATATTTCCTTTTCTCACC
ATTTTTTGTTGGATGAAAATAATCTTTTAGTGAAATTCAGTGTATTAAATATTTATTTTT
TAAAGTCTAGAGATGGGGTCATGCTGTGTTTCCCAGGCTGCCCTTGAACTCCTGGGCTCA
AGCAATCATCTTGCCTCAACCTCCTGAGTAGCTGGGACTACAGGCATGTGCTGCCATGCC
TGGCTTAAATATTTAAAAAATTTTATCTGGCACATTCTGAACACAGATGTTTCTACTTAT
ATTTGTCATGTAGTCACAGTATATATTGATTTTGCTACCTCGCCTACTCCTAAAAGTTTT
AATTCATTTAATTGGTCTTAATTGGACTTAAAAATTTTTTCCCTGGCCGGGCGCCTTGGC
TCACGCCTGTAATCCCAGCACTTTGGGAAGCCGAGGCAGGCGTTTGAGACCAGCCTGACC
AACATGGAGAAACCCTGTCTCTACTAATAATACAAAATTAGCTGGGTGGGGTGGCACATG
CCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCACTTGAACCCGGGAGGCAG
AGGTTGCAGTGAGCTGAAATTGTGCCATTGCACTCCAGCCTGGACAACAAGAGCAAAACT
CTGTCTCAAAAAAAAAAAAATTCCCAATAGATTTTAATCTAATTTTATTAGAACAATTCA
GTCATATGTTTTTTCATGCTATGTATATGAGAGTTCCATTATTCAGATACTAAACAAATG
TCTACTGTACATTTACTCTTCTCACTGATGATGGATTAGATAACCATGCACAAAATAAGC
CTGGCTGTGGAAATGCTTATTTGTTGGGAGGGTGCTTGTTTGGATCGATGATGAGAATAA
TTGTCTGAGGATGCTGAGGGACTCATTCCAGATGTCAATCTGAGGTCCAGATGTGTGGCC
CTCCAATAGGACAAATAAGACTCTCAGAGCCTGGCTCTATTTGGGGATCCCTCAGTGACA
ACATAGTACCTCTGTGAGCGTGCCTTTTCTATCTCTCCGAAGAGGGCATTAGCATCCTGT
CTTATGAGTCAGTATGCACTTTAGTATGGTTAGTGACCCAAGACTCACTTTATTTTGTTC
ATTTTGAGCAGAGAATTGTAGATAGATACATATATGGGAAATATGTTCTTGATTAACAAA
TGAAAAAATGAAAAAGTTTCAGTCAAGAAAGGTCAAGGAACTGTGATGTATAGTGAAGGC
AGGGAACACTGCATGCCTGTATTAAATATTGACAAAGGAACCAATTTTAGTGCTTTGTTA
TTTTTACTGTTGAGTATTTTCTGAGACCATTTCTTTTTCTTCTATTTTGTTTTGCTGAGG
TAGAGGAGGGCTGGAATGAGGTCCTCCACTTCAGAAAATAGGGGTGAGTAGTTAAACCAA
CATCCTTTGGAATTCATATACGTCATGCGTTCCATGCCACATCCTGAGATCTTTTTGTTG
ATTTTTTTAGTGGCTTACTGGATAATATCTAAATACTGTATATTTTACTTTGGTGAGTCT
CTCCACCTTCATTTCTGAATCATTGTCCTTTACATTTTTATTCTATTTGAATTTTGCATG
AAATGACAAATGTAGAATTTTGCCCAATTTATTTTATTTATTCATTTATTTATTTGGGAA
GACAAAGTCTCTCTCTGTCACCCAGGCTGGAGTACATTGGCCCAGTCAGAGCTCACTTCA
GCTCTTCACCCTGTAGCCCTTAACTCCTGGGCTCAAGTGATCCTCCACCCTCAGCCTCCC
AAGTATCTAGGAATACAGGTATGTGTTACCACACATAGCTAATTTTTAAATTTTTTATTT
TGTGAAGATAGGATCTTACTGTGTTGCTAAGGCTGGTCTTGAACTACTGGGCTCAAGCAG
TCCTCTTGTTTTGGCTTCCCAAAGTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved