Homo_sapiens Locus SNHG10
snOPY snoRNA Orthological Gene Database
Homo_sapiens SNHG10
Homo_sapiens
SNHG10
14
SCARNA13
2244..2518
3961
CAACCTCAGCCCTCTCCCCACCATCGACAGCCCTAGACCTTACCCACGAGTAGGCCAAT
GGCTTCCAACCTCCCCAAAGTGTCCGCGAAAGTACCTATCTCACAGTGGGTCCTTACTAT
GAGTTTCCTAACCGTGCAGAGCAGTCAGGCAGCGGGCCACCCTCCTCCGAGTCAGTCATT
GACAAATCGCCCCGAAACGCCTATATTAGCTCGAAGTGAGGATAAGTGAACCTTTAGGAC
TTTACCTACTGCTCAAGTTGGCAACAGTACAGAGCCCCAGATCCTCAAGACCCAGTGAAA
TCAACTACACCCTCAGCCCAGACTCTACTCCAGGGCAGTACTCCTCGCCCTAACCCGGCT
CGAACCTTCAGACAGACCCCGGCGGATGGAGCCCCGCTCCCCAGCCCGGCGCGGCGGAAC
CCCTCGGCCTCGTGCAGCGATGCTCCTGGGCCCGGGGCGGAGGGCGCCTGCCCGGCACAC
TGGCCTGACCTTGTCGGAGCTCCGGGTCGTCCAGCACGTTGTAGGCCGCGTAATCGCGGA
CGCCGTGCAGCCGCAGGATCTGCACCACGGCGTTGCTGAAGCCGCACTGGGGCTGCTCCG
GCGTCCCCTTGAGGAAGACCACCACCTTGTCCTTCTTCACCAGCGCGTCCAACTGCTCCG
CCGAGCCGCCGCCGCCCGCGCCCGAGCCCGCCGCCCGCACGCCCGGACCCCAAAGGCCAC
CGCCGCCCGCGCCGCGCCCCCAGCGGAGCAGAGCCGCCGCAGCTCGGCCGAGGGACCCGC
TCATCTCCGCACGCAAGCCGGAGCCCACGACGGCCCGGGCCCACAGCTGGCCACCCAGAG
CGCTCCCCGGCCCGCGGCAGTCCGACCCGCCCCCTGGAGGCCCTCATTGGGCCGGCTCTA
AACTGCCCTCCGTGATTGGACAATACTGATCAGTAATTACTCGATTCCACCAATCATGTT
GCTCGTCCCGCCCGGCAGGTAGGAGGTGGGCCTTATGCCGGAGCCTCATCCTACTGCCTT
ACTATTGGTCGTCGGCAACCGCTTTGTTAGTTAATTGGAGAGACTGGATGTCCATCAGGG
TCACGCTTGCAGGGCAACGAGAGGCAAAACAAGAGGGAAGACGACTTTCCTCCTGTGAGC
CAATGAGGCCAGCTGGACTACGCCGAGACAACTGGGAGAGGCGCGGGACTCGCCCGTTCC
GCGGAACGCCGGGAAGGGGTCACCTCCTGATGAAGTTTCCGGTTCCGGTGTCAGCGGCGG
TTGAATTGCCATGGCAATGCGGTGGGCGCGCGCTTGTCGTGTTGGTCTCTTGGGAGGTAG
CGGGGCTAGGCCGGGCGGGTATCCGCCTCTCCCAGCTTAGGTGAGCGTCCCCGGGCGCCT
CCGGAGCGCCGCGGCCGCATGCAGTTCGTCGTGGCGGGGAGCCGGAGCCTGACCGGGGTT
CCAGCGCTCGGGCCGTAGCCTTGGCTCCTGGACTTTCCCTGGCTCCGCCGCCACGTGGGA
GCTGAGGCTCTGGGGCTTCCGCCTCCGGCGCGCGATTATTTCTCTAGAACAGTTTTCATT
TTTAAAATTTGTAAAGCGCTTTTGCCTGTGTGATTTCCTCTGGGTTTTTTTTTTTTTTCT
TCCTTTTTGTAGAGACGGAATTGGCGGCGGGGGCGGGGGGTCGATGTCTCACTTTTTTGC
CCAGGCTGGTCTCGAACTCCTGGCTTCAAGGGATCCTCCTGCCTCGGCCTCTTAAAGTGC
TGGGATTACAGGCGTGAGCCACCGCCCCCGGCCGCCTCTGAGTTTCCAGCCTCGTTGGCC
CTCCAGCCTTTTAACCTGTTGGGCCTAGGATCAGGAAAGGTTTGTTGAATGGGGAACTAA
GAAGTGAATTCGTTCGTTCGACAAACGTTTCCTGAGCAGCCGCTGGGTGCTAGGCGCAGT
GCCAGCGCGGAATGTCCAGGGAGACCTGGTGCCCAAAGCTTGGACCCATCGTGAGAAATG
AGAAGCAGATACAAAGCAGTGTGGGAGTGCAGAGGAGACAAAGCAAGCCTCATCAGGCCC
ATTGCTTGCTCTGCTCTCCCTTGTACTTACCAGTGCTTGACAATATACAGTTATTTACTA
GCTTGGTTATTGACTTCCTACCCAGCACTCAGTTTTATTCACTGCTGTATCCTCAGTGCC
TAGGACGATGCTTGGAACGTGGTAAGTGCTCCTATTGGCGGGAAGAATAAATCCGGAAGA
GCAGGACCAGTGGACTTGCTACATAATCTGTAGTCTTGGAGCCGCACAGGGTTGGTGGTA
CCCTCGAGCACACCAGACTTGCAGAAAAAGCATACTCCAGAGGAAGCTGAGGCATGCCTG
CTCGAGAGCCAGCTGTTCCATGTGCAATTTTCCTCTGATAGTTTCTGGTCACTGTTGCCA
CGGTGATAATGACTGGGCTATGTCATTATCTATCCGCCAACAGTAAGAGAAGCTTTGCAG
TCGAGATATTGTTTAGCAGATGGAGTGTTTTCTGTTGAACACTAAGTACTGCCACAAGTT
ACTTTTTTTTTTTTAAACTTTGAGTATTTTTTTACAATGTTGCTGGAGGTGATCTGTTTA
TGCTTTGAGAGTGTTCGAATTTAAAATCAGAAAATCATGTCAGTGAGTGAGTCTTTCAAA
TAATCCTTCGGCATGAAACCTGAGCCTAGTAAACTATGAAAGTAAACTCGGCACATTACC
CGAAAGTCTCAATGTCATATTTTCACCCCCATCAATATTATTGATGATTGCTCATTTTCT
AATGTGGGACCTGAAATTTACCAGGTGCTTAAAGAATCTTTTTGTTTTTCAGATTCATTG
ATTCCAGGTAAATCAGAGGAACAAGCAACATGAACAGAAATATGTAGAAAAAGCTATTAT
GCAGAAGCATAATTGTTGTTTCAGAAGTCCAGCATCTGGTGCACTTAACAATAGAGAATA
TATTAAACTCTTTCCAAAATAACCTGTTGTTCCTACCTGTGTTGTAAGTGTTTTGTTTGT
TTTTAAGTAAATATTGGTGATTTGTTGCCAAAAACCTAAACTGTTTGTTGCTGTCAACTT
AAATAACGAACAGAGAGAGGCTCTCTAAAAGAAAATGGCATTTATTCAGGAATAGAGCAC
TGCAATGAGAAAATGCATGCGATAGTTAACTGTGTGTATCCTGGGAGATAGAGGAAGACA
AAGGTCTTTAAAGGAAAAATGAGGAGGGTTACATAATTGTTTTGAGATAATTATTTTTGA
CTACAAGGATCAGTAACAAAGGTGACACCAGTCCCAGGTTGGACAGGCAGGTGCTCGGCA
GGCATTGCAGAAGTATTTTTTGTGTAAGATTGAGATGGCCTTTGTGCAGGATTGTGGTTT
TGGAATCTTCTGTGATCGTTTTTGCTATCAGGCATTTATGCTTGCGAACTCTTTATGGCC
TTCCCTGTGTCTATTTTGATTCCACCTTTCTCATTGCCCACTCTAAACTGTAATTCTGCT
TTTATGTTGACTGAGATCAGGAGAAGAATTTGCAAACTTATATCCTGAGACAGAACAGTA
ATGAGGAGTATCGTGTTCCTTACCTAATGTATAATATTGGGCTCAGAAGCAGTTGTCTTT
TTTATTTGTTGAACGTTGTATTAAGTTGAGAATGCAGCTGCCATTAAAGATTAAGAGTAA
TCCTTGAGAAGGAAGAGTACAAAGCCTGTGTTTTGCTAAATCATAGTGAAGTTGCCGTGT
TTTTGTAGAATATGATAAGAACATACAGTGTGTGAAATGCTAAGGATATGGAAAAGCATG
TTGGTGCTCTTTCAAGGAGCTATTTTGATAGCATGAGCAAGGGCAGGAAACAGATCATGT
ATCTGAACCAAAGAAATTGAAACAATACATCTAAATTTAAATTTTTAATAAAACAACCCA
AAATATAGTGAAATACTTAGCACCAAACATCAGTGATCTTAAGAAGCAAAGAAAACAGTA
TT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2180, 2812..2961
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved