Homo_sapiens Locus RPS20
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPS20
Homo_sapiens
RPS20
8
SNORD54
1606..1668
3451
GGCCTGGACGGAGGGGTCAGAGCTCTGTCCCTCCCCATTTCAGAGTGTTTGAGCAAATA
ACTCTTTCGGCTCAGAGCTTCAGGTGGAAAGTAATATGAGATGATTTTACTCTTCTTTCT
GCCCTGTATCAAAATCCATCTCAGTGATTTCCACGTATTTAGCCCCGGCTTCTTGCTCAG
GTGTAGGTGAGCTCACCCTGCGCTCTCTCCCACTGCTCAGCTCAGTTGACCATTCGGGTT
TTCCACTATACTTGGTCACTTATGTGATTATGAACAGATGTTCAGTATTAAGAAGACCCT
GGGGGATCTTATCCAATGACTTTATCCAACAGAAAGGAGATGAGGTATCAGGACTGGGTG
GCTAGCCAGGTTCCAGGCCGGGCCTCAGGATAGCTGCGCAGCCTGGCATTTTCGCCTCAC
TTTCCAGAAGGACGAGAAGCCAAGTTCAGGTCCTTTCCAGAAATAGATGTAGATACTTCT
GCTGGACTGGGAAGCCAGGAGCTGAAATATCACAACAGGACGTTTCAGGCTATGAAAAAT
AACTGCTTACTAATTCTAACGTAAGTTATCCAGATTACGAGAAGCATTTCTGCCAATGCT
CATGTCAGCTAAGCTCAGAGAAGTTACCTCATCCTCAGAGAGCAACGAATGGTATGGTCT
ATGTAGAAAGCAAAATTTGCAACGGAAAAACCAGAGTTCGTGTGCACTTTATGAGGAAGA
GGGTTAGGTGCACCAGACAGAGGAGTTTCTCAGGTTTCCGTGTCGCCTGTTCTCTCGACC
AGGTGGCCCTCTCGGCGCAGGCGGGGACCCCACCCTGCGGGACTTCGGCTCCTCCGTGCG
GACAGGGGGCGCCCGCAGCCGTGCCTTTCCCGCCAACTCCACTAGTGCTCCAGCTCGCCC
TTGTGCGACCGCCTCTAGGGCCCGGGATATTTCCTGTTCCGGGGCGTGTGGGACCCGGAT
GCAAGCGTGCTATATAAGCGTTGCTCAAGTCCCACCCCTTTCTTTTTGAGGAAGACGCGG
TCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTCCTGACTCACCGCTGTTCGCT
CTCGCCGAGGAACAAGTCGGTCAGGAAGCCCGCGCGCAACAGCCATGGTGAGGCGGCAGT
CGGCGGCGGGCGGCGCAACGCAGGGCTCGGGCGCCGGGGGGACCCCGGTTTCGAGTTCGT
GCTCCTGAGGGCAGATGCCGGGGCGTGTAGGGGCGGAAAGGCGCTCCTGAAATGGTGGGG
AAACGCGGGAAGCTTCCGGAAGCTGCCTTTCTCCAGAAGTGGCAGACCATTTTTGGCTTA
TTGTTCTTTTTCATGTATCTAATAATAGGCTTTTAAGGATACCGGAAAAACACCCGTGGA
GCCGGAGGTGGCAATTCACCGAATTCGAATCACCCTAACAAGCCGCAACGTAAAATCCTT
GGAAAAGGGTCAGTGCATTCGTTATGCGGGGGGGAGGGGGAATTGGGCGAAAAGCGACGA
GCTTTACTCGTTAATGTTAGTGTAGAAGGTGGACTGCAAGAACTAAAGTGACAAGTTACT
TAAAAAAGTAAAGCGTGGCTTAAAATTGCTTTTACTGTCATACAGCTGGCGATGAGGAGG
TACCTATTGTGTTGAGTAACGGTGATAATTTTATACGCTATTCTGAGCCAGCAGAAGTGA
AGGCCTTAAGCCGATTTTAATTGTTTCGATTATACTGAGAGGTCTTTTATTTCCTGTAGT
GTGTGCTGACTTGATAAGAGGCGCAAAAGAAAAGAATCTCAAAGTGAAAGGACCAGTTCG
AATGCCTACCAAGGTAAAGTAAATCGGAGGGGCAGGAAGTAGGAGTTGCTTCCGGATGTT
GCATAAATTCAGGTTCTTTAAGGAGTTCGGCTGCCAAAATTGTTAACACTGATGCTGTCT
ACAAACGCACATAGAAATCGGTGGTAGATTGCGGTTCCTAGTAAGTAGCTAATGTTTAGA
TATGATTGTTGAATTATTGTTGCTGTGTTCTTGGTGTGCTTTGGTGCTTAACAGGCGCAA
GCTCTAAGGGTGGTGTCCTAGCACAGTGAAAACAGACCTGGCATTTTCAACCCATGGTAC
CTGAAAATCTATTAGTGTAAATTGGAATCATACCAAAGGGAAACTAATGAAATGATTAGA
AGTAATGATTTTCCAGATGTTCTAGGGATAAGTATAAAACGATAAACACTTGGTTTCCTT
TGTCTTTTGTTACAGACTTTGAGAATCACTACAAGAAAAACTCCTTGTGGTGAAGGTTCT
AAGACGTGGGATCGTTTCCAGATGAGAATTCACAAGCGACTCATTGACTTGCACAGTCCT
TCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGGTGGAAGTC
ACCATTGCAGATGCTTAAGTCAACTATTTTAATAAATTGATGACCAGTTGTTAACTTCTG
TTGGTTTTTATTCAGAATACTGGCAGATTTTAGGAATATAAAGGTGTACTATGAGACTTC
CACTTTTCAGGTGGAATATATGGGTATCTTAGAGTGGTCTATCCTGTTTTCGTTGTCGTT
TGAGTCATTTGAAAACTGGATTCCGTTAACTACATAATATGTGAGACCTGACTGGTTTTA
TTGGACACTGGCAGTTTATAACTTTGGCATACTCTAGATAAATTCTGATTGGTATGGGGT
GTTAAGGTTTCTGGGGCGTTTGTAATGCACACCCATGGTTGAGAACCTAGTGCGCTAGTA
GGCACGTGTTAAAAAGCTAGTAACTAATATTTTTAAATTAACCAAGTTTAACGTCCTTAA
AAAAGGATTAAGTGGCAGAGGCAGGACTAAAACTAAGTTTTAGGGTTTTAGGAACTAAAA
CTTAGTTTAAAAATACTTATATTTTCAGTGTTTTATATTTTAAATATAAAATTTTCACTT
TTTTTTTTTGGGGGGGGGGACGGCGTTTTGCTCTGTGGCCCAGGCTGGAGTGCAGTGGTG
TGTTCTTGGCTCACTGCAACCTCTGCCTCCCAGGTTCAAGCAATTCTCCTGCCTCAGCCT
CCCAAGTAGTTGGGATTACAAGTGCCTGCGACCAAGCCTGGTTAATTTTTTATTTTATAG
TAGAGATGGGGTTTTGTCCTGTTGTTCAGGCTGGTCTCAAACTCCTGACCTCAGGTGATC
CACCTGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCATGCCTGGCCCA
TTTTCACTTTTACATTTTTTAAAAATACTTATATTTTCAGTGTTTTAGACAGGGTCTCTG
CAGTCCAGGCTGGAGTGCAGTGGTGTGATCACTGCAGCCTTGACCTGGGCTCATGCAATC
CACCTCAAACTGCCTAGTAGCTGGGACTTAACAAGCATGTGGCTACCATGCCCAGCTAAT
TGTTTTTTGTAGAGGTGAGGTTTTGCCATGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1126, 1348..1447, 1739..1812, 2235..2452
1124..1126, 1348..1447, 1739..1812, 2235..2414
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved