Homo_sapiens Locus RPL27A
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPL27A
Homo_sapiens
RPL27A
11
SNORA3, SNORA45
2436..2565, 3648..3778
5055
tacataagggttatactagattgtgtggtggtacaggtggggaagcgagcaactgtctg
cattgtgtccaggaaagggtcacaggcgtgttatgtagattctggagaaaattcaaaaat
agcatttatttttacttatttacttttgtatgtggagacgagggtctcactatgttgccc
aggctggtgttgaactactcgcctcaagaaatcctcccgcctcgacctcccaaagtgttg
ggactacaggtgtgagccaccgcgcctggcctaaatgtggcatttagaaaaagtatttac
aacatctgcattaaaaggaccataaagcaaccaggcatctaagtccctgaagcaatttaa
gttgctcaaacttgagaggacaaccaaatgatagcaaaagggcaaaagagaaaggaagct
gcagtgcccactcagaagtgtgagagcgggagaaggcatttcgggagccgcccgagcttc
aggaaaccgagcgagacaccaggtgggcacactgaggattaaagagggcctcgcggttcc
gcactgcggccgggagacaaaccagtagccactatcaccagccccgggcagaccactaag
aactgtggaggtgcgcggggcggctcagggctggcgcatttggtgaggagctcagacaac
gaggcccttagggtcggcttaggcggttccctgaccaaggcgccagaaaagggcctggct
caagcaagcacgggcggcgtgcagtacagcacacctagccccgattcttcaacagttctc
gccctccgagcctagcacaacgagcctcaccgaaaccgtacaccgccaccaggacactcc
gtgatgggggatcaccaccctcagaaagaggaagcgactagcaggcgcgcaatcccgcga
gaccaggaggccccgcccgaagcccggcctctgtgaccggaagtgaggcgttttgccccg
cccccgtggccgatacctcgcgagacttggcgaaggccttcCTTTTTCGTCTGGGCTGCC
AACATGgtaggtgtttcgtttcttgcctcctcttccttgccggcggagacccctaagctg
tattcccattgcccctagtcatccactccctaccatggtcggggcttccaggctgcgcat
ggccgcctgcggggcagggtggccggcgcgggcccggggcggggctcccggagccgtgtg
ttaggcccgcggttcggatctctaggacacgcgggcccctgcgctaccgtggtgagacct
cacggccctgagcggatcggtaccctcagctttcccaaacgctccagaagttaggtcttt
gacccacaggcttacaggaccatctcggctggcgggcatcgccccctgcccctaattcct
taggccttaccaccaagctttttccacacagCCATCCAGACTGAGGAAGACCCGGAAACT
TAGGGGCCACGTGAGCCACGGCCACGGCCGCATAGgtaagtgccggcttcccctcggggt
gggccttgggctctcttcgggtgcttagctagtctggagatcggtagcctataagtgggt
tagaataagacctttttgtggtcaagttgcacagctgttgatttttttctgacgatcctc
tagtattccagttctaaggaatttcacatcagtggggtaataggaattgagcaggcacgg
tattgggttagttgaagacatggagtactgtgggaatgctgtgatgtggaacctgaaaag
atgtttcacccggaatcctaaagtaatcgcattgctgaaaaccggcatcggtagggtggg
aacagcgtaagcgggacacagaagtctgggaaacactctgcttttgtgcgaggaagtatt
gagatgcatgagaaggctgtgtggtgcatgtagcttttttgtgtgtgtgtgagactgatc
actgtcgcccaggctggagtgcagtggcgaaatctcggctcactgcaacccctgcctgcc
gggctcaagcgattctcctgcctcagcctcccgagtagctgatattacaggtgtgcgcca
cgacgcccggctaattctttttctatttttagtagagtcgggggtttctccgtgttggcc
aggctggtctcgaactcctgacctcaggtgatctaccccccctcgtcctcctaaaatgct
gggattacaggcatgagccatcacaccggccccacgtagctttgtattcctgcagGCAAG
CACCGGAAGCACCCCGGCGGCCGCGGTAATGCTGGTGGTCTGCATCACCACCGGATCAAC
TTCGACAAATAgtaagtgtccttggactgcttttattgacacagcttgggaggtaggggc
agagagagggctggcttaaacaaaaagtttagaagcaagccttgcctattgctgtttttt
accaagttaacacttggtgtgaactgagaacctgtcatcgaggctagagtcacgcttggg
tatcggctattgcctgagtgtgctagagtcctcgaagagtaactgctgaccttattcact
ggctgtgggccttatggcacagtcagtcaccaggttagagacatgcttcacattcaccta
cccacaaactagtggatgataaattttggctattcagaagacgtttattataggagtatg
tagattttccatagagtgctgttatgtgacttgaattttagtctcggccctgcctctgac
attgtcggtggtttatcctggttccaggaaataagactagccttttcctcatgatagtct
ttggtggtttttaaaacagttgtttaagtcaacagatgtatcatatgcctgacactgctc
tacaccagtgaataatttacactctaatagggggtggtaactataaagatgataaacata
gcatcttaattggagtgtgtatgaaggtggttgttacctcttcctagCCACCCAGGCTAC
TTTGGGAAAGTTGGTATGAAGCATTACCACTTAAAGAGGAACCAGAGCTTCTGCCCAACT
GTCAACCTTGACAAATTGTGGACTTTGGTCAGTGAACAGACACGGGTGAATGCTGCTAAA
AACAAGACTGGGGCTGCTCCCATCATTGATGTGGTGCGATCGgtaagttaattggatgtt
tttctgtacttccataccttcccttacaaaactctggcttaatctaatccacttatataa
tctgtacttcccagttacctaccagacattgatattcttcctgtggtagaattatcatag
gtagttccctatccgtagcagtgcctactgtcactgcccaggttgtatcaggtttgcatt
tcgtgcttgaactatagctggttttcactgagcacagctcttggcccttcatgttctcca
gataatagaatcctaatatgttccattgatactcagtgccatgcattatctgaagagatt
ttcccccaaaacagatgtattatgtctgtccttgcgggggttctggtccctgtgtcagtc
ttaactctcatgaatatagaggtagtgttaagaggccagaaccctagggacgctttaaat
tcacttcccagcctatttaatgtccattgagtagttctggtggtcaggaaggtggttgtc
ttcttttgcttagcagggggtatttgagcaggaggaggcttatgctttgccgagactaga
gtcacatcctgacacaactcttgtcctggtgtgctagagtactcgaagagaatctactgg
tcttgattcactggtgggggcagtcggtgcccccgttagtgcccagatcagaaacataca
taccctgcctagggatttagaaagtgggttggcagtctttcctcacgcccatcacgcagt
tggtacctactacagtgtattgtaaacttttttctctgttcttctagGGCTACTACAAAG
TTCTGGGAAAGGGAAAGCTCCCAAAGCAGCCTGTCATCGTGAAGGCCAAATTCTTCAGCA
GAAGAGCTGAGGAGAAGATTAAGAGTGTTGGGGGGGCCTGTGTCCTGGTGGCTTGAAGCC
ACATGGAGGGAGTTTCATTAAATGCTAACTACTTTTtccttgtggtgtgagtgtaggttc
ttcagtggcacctctacatcctgtgtgcattgggagcccaggttctagtacttagggtat
gaagacatggggtcctctcctgacttccctcaaatatatggtaaacgtaagaccaacaca
gacgttggccagttaaacatttctgtttataaagtcagaataatacctgttgatcactga
aaggcctgcatgtattgtactctgaattttacagtgaatgagagaatgtaccctaattgt
tcaacagggctcaaaaggaaagattccattttgatgggtcacattctaaagaggggcagt
gtgataggaatgagatggtcctttaggacttaagttctcagcccaaggtttttccacgtg
gccccctcatcttttttttttttttaaacggagtctctcttgccaggctggagtgcagtg
gcacgatctcggctcactgcagcctccgcctcccaggttaagcgattctcctgcctcagc
ttcctgactaactgggattacaggcgcccaccaccatgcccagctaatttttgtattttc
agtagagatggggtttcaccatgttggccatgctggtctctaactcctaacctcaagtga
tctgcccacatcggcctccaaaagttctgggattatagtgtgagccactgcgcccggcca
tggctccttaatcttgatccaaattattgttacatccagaatgtgatgaatcaaaatctc
gagatgggggtccagcaatctgaaatttcagtatgccagggcttttctgtatgtcaaagt
gggtttgaaatagttaatttttcttctagtctgaaatgtatcgggaaaatttggaaatcc
tgaaggctggaaattgaaataagtttttctaggatttgtgtctcttgctattggaaaact
gatggtgaccaattcatgtttacaaataagatcctcatagatctcggtaaattataattt
gctacagttttatggt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1411..1474, 2215..2290, 2927..3101, 3887..4055
1023..1025, 1411..1474, 2215..2290, 2927..3101, 3887..4015
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved