Homo_sapiens Locus RPLP2
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPLP2
Homo_sapiens
RPLP2
11
SNORA52
2714..2847
4909
ggtgctcgcccgggatattggcagggatggctccttctcatctctcagctcaagctttc
tcaggctgcccagaggaccaagtctccctctgtccctgtccttcggatcgcctccctatt
cacctcctgcgtcctcgcacaagaactcaagtccttaggaggcagggccaaccctgttcc
ctcccaggacccgagaatgtagcggggtccctgaggtgctgatgtccacatggacaccga
ggtcagttccgggccaaagcggccagcgcaggggctgaccactcagacctcactcctcgc
aggggtgagcgggcgacgctgcctcacgtcattgtcctgccctccaaggcccgcgctcgt
cctctgacaggatgccctgacaccgcagtgcgggggcggcctcccagatagggccgcagt
cgctaagtccgaggcggctggctcacctcactgagcccggctggacgtgggaccaccggt
cgccgcggccagggaaccaccaaggagtcaaggcgagcctaccgccagcagcttctgccc
gggcccacgcgccgttccgggtaggcccgcggcgcaggccacttccggcagcggtgcacc
atgggacttgcagttcgctggcaaaggttgagtcccgggcgtggcggccgcgctccatgt
tgggagctgtaggcgccgcgtggcatgctgggggtgctaggtaccgaaggcagatgccgt
ccctttggactcgcttcgtccaacgcccccacgagtttcggtggcccttcgccccacgct
ataagagcagtcacttccggaactgctgcccttcgcctttgccgcgaaaagtgcctgacg
ggggctgggaagggggagggggaaggagtcaacgactccctccccgtcgtcattggctga
gcgcctcgtgacgtcactctgaggcgcctcatgcggcgccgcgcacgggtcccagagcct
tctgggtagcggtttaaccccgcctcttgcgtcggcgccttCCTTTTCCTCCCTGTCGCC
ACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGCCGCAGACGCCGCCGCgtgagt
gtggtgaccgggcccggggtgccggctggggacgcggagtccgtggggatgcggggtggg
cggcggggtatttttgggacggaggcctacgggccgagccacgcgcggcctcgcccggcg
gccccgggatgggccggcaggaggccgccggggtaactccgccgtcgcgtcctctccgcc
cgcctcagGATGCGCTACGTCGCCTCCTACCTGCTGGCTGCCCTAGGGGGCAACTCCTCC
CCCAGCGCCAAGGACATCAAGAAGATCTTGGACAGCGTGGGTATCGAGGCGGACGACGAC
CGGCTCAACAAGgtagcggccgcccttgccccgcagccgccgtggggccccagtgtccca
tacaggcgattcttctgcctgatccggccacatgctggagggttcggggagaggctcgtt
tcagtctagttggcgatttcttggatagagaagtaagccgggcggaggtcgggcgcggtg
gctcacgcctgtagtcccagtactttgggaggacgaggcaggcggatcacctgaggtcag
gggttcgagaccagcctggtaaacatgtcgaaaccccatccctactaaaaatacaaaaat
tagccgggcgtggtggtgggtgcctgtagtccccctacttgggaggctgaggcaggaaaa
tcgctcgaacccgggagatggaggttgcacggatcgtgccactgtactccagtctgggtg
gcagaaggagaccctgtctcaaaaggaaaaaaaaaaaaaaagcagggtgggtacgaggca
aaatcgtgattaacaagctttggaagtttaataccagtgagctgcgtaagattgctttaa
aaaaaaaaaaaaagcagtcctggcgcatggctcacccggctttgggaggccatggcgagt
ggattattggagccttgaagttcgagactggtctggaaaacattgcaagacccggtctcc
acaaaaaaaaaaaaaaaaaaaatggttggaggcagtggtgcacatctgtagtctcagcta
ctcatgaggctgatgcgggagaatcatttgagccttagaggtcaaggctgcactgagtag
tgattgtgccactgcagtctaacagaaccaggcctcgtctctaaaatacaataaaaaatt
agccaggcttggttgctcatgcctgtagtcccagactgaggtgggatagtcacttgagcc
cgggaggtcaaggctgcagtgagatcctaccactgcactccagcctgaagtcaaagtcaa
tttcattgccagtttattttgccagtgttgaagatacctatgagtagtcaacataagtag
tgagatgccctgtgtccttttgtcagtcctaagtctaagaaagctagtgtccatttattt
ttatatcacttcccaagtgaggctggtggctccctttgggcagtgcagttctggaaactt
cagggcctattcccatgtggggaacccagtcctgctgtgactctgggagggagagggccg
gggatacaatcgtacattcctggtaacagccctgtgattgtctgcttcagGTTATCAGTG
AGCTGAATGGAAAAAACATTGAAGACGTCATTGCCCAGGgtgagttgatgtggacgggct
ttcgtttgttttcatggtccatcctaatccctgccggtccatctgtggcctgccaggttt
cgcttgtggaccagagcaccctagaagcctcacccgaggagtgagcagggctccagtggg
ctcacgtcatgggcacttctagacactctcaggagcagggcagcagggggcaccctgtgt
tctcagcagacgtttaggtggccctgcctcttaagcctgactgctcctagccctgaggcc
attccccaggatttgtctgaagcttggtgtctggagaactgagttcacgtcagcagtcct
taccacatgctttctgtgagggggttgggggcagggactgagggtgccagggatgtccat
aggctccttgcctctttgttgggcagatggttttttgttggcttcagctgagctggtgga
acttgtttggaagttgagctgttggggcagctgttcttgtcttccatgcatgtgaccacg
acagggccagctcagcaaacgggccaagccatgaacacagcattgtggccagagatgtgg
atactggggcagcacactcattccctacctagttatgaacatgtctgtccagtggacctc
tgagggtggaggtggggaaattgggcaggcaggcagtgtgggcctaattcctagaaggca
agtccctggataggaaaggtggggaagagaagtccccgttgaggagtggctcagggaggg
agtgttcaggaagaacgggagacactggcatatggtgggtccagatatgttgggtgccat
gtgccatctctggtgccatctaacttccctgtggaacagcctcccaggctgggcagctgc
tctggtctcacctctctgctttctgtagGTATTGGCAAGCTTGCCAGTGTACCTGCTGGT
GGGGCTGTAGCCGTCTCTGCTGCCCCAGGCTCTGCAGCCCCTGCTGCTGGTTCTGCCCCT
GCTGCAGgtaagtggtggcctggtgagtgggcaaggggctggggctcagacggtgttgct
gcagtggggtcttcatggggggactggcctggcacttgggcagtgctcaccatgcctctc
ctctgttccacagCAGAGGAGAAGAAAGATGAGAAGAAGGAGGAGTCTGAAGAGTCAGAT
GATGACATGGGATTTGGCCTTTTTGATTAAATTCCTGCTCCCCTGCAAATAAAGCCTTTT
TACACATCTCtcaagtattccatgagcactttgtcaagggtggcctctgcccaggttctt
atccaagagggcaggtgtggagctgaagtgtgggcaacatggtattggggaagcgtttct
ggtgcaaaatgagcatgaggaggggagtctgggcatcacagctgcctggggtcccttcct
gtggccttgagcagtatcctagctcctgagtacaccccagaagaatgcgaacgggctggg
cacagtagctcgtgcccattatcccagcactttgggaggccgaggagggaagatcacttg
aggccagcagtttgagaccagcctgggcaaatagcaagaccccatctctaaaaaacaacc
taacaaggcgtggtgtgcacctgtagtcccaactatgagaagttgagatggaaggatcac
ttgcccaggaggttgaagttaacagtgggccgtgatagtgccactgcactccatcctgag
cagcagaaaccctgtcttgaaaaaaaaggacagcagagaagctgatttcaatggagtttg
ggtaatcagggctctgtctttggggtggcttggtgcctggacttgcaaggacaggattgg
tagcccctgggctctacaaatggatgcaggaagtgagcccagcttgggggtggcagatgc
ccctgggtttccctgcaggggtcatggctccgccataatgccctgagcaacttgggcaat
cactcctcaggcttgtttttttgccgatcacagcccacccctgccttactgggcagatgt
gctcagggcttgtgggaagtgaccacagggccatgtgctcactgaactaggtcctttggg
gatgggcctgccctcccccgacaggctctgtcctggaatacagggctaaggacagaggcc
atcaccctcccctcccagcctctctgccctcctggccttactccgtacgcagtctcccag
gcctcagggtctttgcccgccaacgtaggcacccagaagatggtctgcca
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1073, 1268..1391, 2630..2678, 3568..3666, 3793..3909
1269..1391, 2630..2678, 3568..3666, 3793..3869
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved