Homo_sapiens Locus KCNE1
snOPY snoRNA Orthological Gene Database
Homo_sapiens KCNE1
Homo_sapiens
KCNE1
21
SNORA11E
4368..4495
14915
TCTGCCTGGTGCACAGGACACATCGGTGCACCCCTTGGAGGGCCTCCAATCACCCTCGT
CCCCATGAGAACACCGAGGTCGAAGCCCAGGAAGAAGTGACCTGCCAAGGAAGACCATGG
AGGCAGTGACCCTAGAGAATGTCTTCTAGTCCTAGGTCAGGAACCTGCCTCTGCGACCCG
CCTGCAGAGCAGGAGCCTGGAGCCTGGACGTCATTCCCTAGAAGGTTCATGGGATTGTCT
TTTGGGGACTGCCCCTTCTCCTCTTGCCTGCCAAGCTGGTGAGCAACGCTATGAAATTTG
CTGGGAAGTCACCTGCATCATTGCATGGTTTGCTCTCTGGACAAGGACGGCTCGGGCTGA
AAGGCCCCAAGGACGTTAGGGTGTGCTCGCCAAGGCTCGGGTGCCTCCAGCGACTGTCTG
CCGCTCCGGGCCCCCTCCTGTCTGGTCCACAGCTGCACCCCCAGCTCAGGGCTGCACACC
CAGTAAGTGGGTGCTTCATAAATGTTTGCCTAATAGGTGTGTGGCCACAGCTGGGGTGCG
GGACGAGGCTAGAAAGAGTCGTCGGGAGCGGAGGTTGAGCGGTCTTTGGAGGATTATGTT
CAGAGATATTTGAAGGCCCGCACGTCCGAGGGTGGGGTGGTTCCCAGACGGCCTTTCTCC
TGGCTGCAGTGGCTTCCCCCCTGGCAACCTCAAACTCCCGCAGGAAGGTAGGTAGATCTG
TCCGTTGGTCGGCTTTCTCGATCCTAATGCAAACCTTCTGCCGGCCTTGAGCCTCTCCGA
CAGGATCTAAAACGCTTCCCTACGCGCGTTGGTGTTGGTCTGGGGTGCAGAGTGTGGAGG
ACCCGGGGGGGCCGGGGCTGGTCTGGGGTGGTCCCGGGGAACCCTGGGCTGGGCCGTGCG
TGTGGGCGGAGTGGGGCGGGACGCCTGGCGGCTCTGGGAGGCCCCGCCCGCCCCCATCCC
TGTGCAGCGCTCAGGCCCTTAGAAGGTGCCGCCCCGGGGCGGGGCTGTCTGTGGCCTCAG
CGCTCGGCAGGCGCGCACTCAGCTCCACACCCGGCTCTCTCGGCATCTCAGACCCGGGTA
AGTTAGGGTCTCCCACCTCCGCGGCCCTCTTCCGGGGCGCAAGTGGCCTAGTCGGGCAAC
CCCGGGGGGCTCCTGGAACCTGCGTCTCCGGACGCGCAGCGGGCGCGCTTCAGGCTGGAA
GCGCCGAGACCCCCAGAGTGGGAGACGGGATAGGATGATCAGCCTCTCCCCTCCTTTCCT
TCTGCCATTCTCACTTACTTATACAACAAACGCATAGGAAAGCATCTCACCAACACAGAA
CAACGAAAACATTCCTCCATTATTAAGTTATAGACATTCTTGTATAGTATTTGGAAAACA
CTTACATGCAACTTTCAAAAGAAAAGAAAATCAAAACCACTCACGGGACCTGAGTCCCCA
CTTTTTTTCAAAGACCTTCAGCTTTTTGGGGGGACCAGCTCTTGGGCCTTGGCATCTCCC
TGAGGAAAGGGCATGGGACGCGGAGAATATTACTGATATCTGATCTTGATTGTGGTAATG
GGAAAAGTGGGAAACTTTAGAAGAAAGTTGACTAAGTAGCAGAGACGTGCGCATGTGCCC
AATCTATTGCATAATGCTTTGCCCCCCGGATTTGTCACATTGCTCTATGTGAATTGACAG
TTCATTTGAGTCCACATTTAGATTAAGAAGGAGGTTCCAGCTCCATTAAGGAAGGACCTT
GTCAATAACCATAGCTGTCATGTATGGTCCAGGTGGTGGGGACTTTGCTGAGTTCACACA
GTTGCTTAAATTCAGCCGTGACTCTGATTTCCAATCACCAGGAAAAATCCCTCTGCTTTC
TCTGGCCAGTTTCACACAATCATCAGGTGAGCCGAGGATCCATTGGAGGAAGGCATTATC
TGTATCCAGAGGAAATAGCCAAGGATATTCAGGTAGGACCTGCTTTTGATAGGTTATTGG
AAAATGATTTGTTTTGAAAATAAAGCTCACTTAGAAGACATCAGAGGGACTCATTGCTGT
CGTCTTAAATCTCTGAGGGTGAGACAGCTCCTGTGTGGTTTCGCTCTTTCTGGTAGTTGA
AAGGAACACTTATTATTCATGCGTTCACGCATGCCTGCCTGCATTCGCTGAATGTTTATT
GCACTCCTGCCATATGCCACACACTGTTCTAGTGGCCTGGGATGCAATGAAGAACAACCC
ATGCAAAGATCCCTGCCCGCAATAGCTTACATTTTGGTGGGAAAGACAAACGTTGAACAA
TCAACATCACAGTTAAGAAAACTTTATTATATTAGAAGGTGATAAGGACTCTGGGAAAGC
GGGAGGAAAAAAAGGTTAAGAGTTTGTGCTCTACTATTAATAGTCACTGACTGCCAAAAT
TTTTTTTTAGAAATAAGGTGGGTTACACACACACACACGCGCACACACACACACATATAT
ATATAGAGTAAATCTTAATAAACAAAATGAATAACAAAAATATGTTAATAATATAAATAT
AAATAAATAATATAAAATTTAATATATAAAAACATACTACATTGCAAGAGGTTTTCCTCT
GATTACTCAATAATCTATTTCCAGAGCATAGTATACTTTATCAATTATTCACTCACTTTC
CCATTGTAGTGGTATTGAATCTAATACTTTGCTTCCCACTTAATTCAGGAAAACCTTATT
GAAACATTCTGGGTGCTGGAGTGGGGACAAAGGTGAGCAAGATGGTCTCTGTCCTTTGGG
ACCTCCTGGGAGAAAATGCCCAGATAAGTCTACAAATGATTAGAAGTTAGAATATGACCA
GCACTGTAGGAAAGATATATACAAGGGGTCAAAGAAGGGGAGAGGATTCTGGATCAGGGT
CAGACACAGTGTGGATATGAGCTGGCATTTGAAGGGCCAGTAGGATTTTAACAAGGGAAT
ATGGTGGGAATGCCTCACCTACAGCGAGAACAGCAAACATAAAACAAGAGGCCAGGCACG
GTGGCTCACGCCTGTAATCCTAGCACTTTGGGAGGCCAAGGCAGGTGGATCGCTTCAGCC
CAGGCATGTTGAGCCTGGGCAACATGGTGAAACCCCGTCTCTACTAAAAATACAAAAATT
AACCAGGCATAGTGGCATGCACCTGTAAACCCAACTACTTAGGAGGCTGAGGCAGGAGAA
TCACTTGAACCCAGGAGGCGGAGGAGGTTGTAGTAAGTCAAGATCGCGCCACTGCACTCC
AGCCTGAGTGACAGAGCGAGGCTTGGTCTCTAAAATAAAATAAAATAAAGCAAGAGCTAG
GAAGGCTGGGGGCTGATTCCATGCTGCACAAAGACCTGGGATATATACTCAGGGTAGATT
CCATCATTCTCACTGTTCAGGTGAGGAAACTGAGGCTCCCCAGATTTATGTCATTTGCTG
AAGATGAGAGTCCTTCCTTCCCTCCTGATGTGTGACTTCAGCTGTCATTCATTATCCATC
CCCAAACGCCCACCCATGTTTTCATATTGAGTTTGATGGAGTCTCCTCACCAGCTCGCTG
GCCTGACTCTCTGAGTATTCAGTGTTTATATTTCCATCCTTCACACCCCAGACTCTCTCT
CCATCACCCATAGAGAGGTCTGGGAAGCTCCTGGTAAAAGCACCAGACTCAAGCCACACC
CCACATCCCCCTGGGAGGTGGCAGGAAACACTTTCCTAATCAGAGAGGACAGTCTGATTC
TGGGCCTCTGGACGGTTGCATTCTGATTCCTTGAGCGACCCTGGCCACCTTAGTACCCAC
TGACTCTGGGGATAGGGGAAGGATAGAAGACCAGACAAAGCCAGCCAAGTGTCGGGAAGC
ATCTGGTGGCCCTGGGTGGCTTCTTTTCTGCTAGGAGGGAAACATGTTTCCAAAATTTGG
ACATAGTGTTGTGATAAAGATGAAAACAATAGACAGTTGGTTCCAAGGACAATTGACTCA
GAATTCTTGTCTCAATAAGATCATATTCACCAAAATGAGGCTTATCCATCATTGCTTTTA
CCCTAATTCTGCTTCTTAAACCAAATGAGGCCAAATGATGATGTTAAGACTGGATGCTCT
TTCGAAGAAATGCATAAGGAGTCCTGTCGAGCGTGATAAAAAAACCCAGAGTCAACCTAG
GGAAGTAAGTTAAGGAGCCCTCTAGTTTATCTAGGATTGACCTGGGGCTGGAACCCAGAT
TCCTGAGCTCTGACTCCGACATTCCTGTCTCCTCTACTCACCCCTAGAATCTATTCCTTT
TAGAAGAAAGCTTGGAGTCAGCCACAAGAACCTTACCCAGTCACTAAAGGCTTAAGAAAG
AATGATCAGGAACTGGGGGAATTTGCTAATAATAACAAAAGAATGAGAGGGGTGCACTCA
GGGCAGGGGGCTTGAAGAACGGCTCCTCTGTTTACGACACACTCAACAGGGGTGTGAGGT
CACAGTGATGAGAGGCCCAAACTTGTGGCCTCCCCGTGAACAAATGCCCTACACATCTCC
CCTGCAGGATCAATGGGACAGGGCTCAATATTGGGAGGAAGGCTGTAGTATTTACTTGGC
AAGCCTGCTGTCTACAGCCTGCCCAGTTTATGCACGGGTAGGCCACAGTTGGTCTTAGAA
ATAAAGGCTTTGGAAAATTAAAAAAAAGAAAGAATGAGAGTTTCCCATGCTGGGAAAGCT
TCTGTTCTGAAAGCTTCCAGGCTGTTATCAGTGCTGATAGGCGACACAGCCGGAGCACGT
GGGAGAAGTCAGAAGAGGTGGTGTGTGCCCAGAGCAGCGAGGCGCCACCCACTGCCCTCT
TCTCCCCTGGGTTCAGCTGGGGGCCTTACGGAACTCCAGGGTGCTGGAGGCCCCGTTGGT
CTCCATTTGCAGGTGTCTCGCTCAGCGCAGCTGCCCAGAGCCCTGTGTCCTGAGTGATTT
CCAGTAGATTAGCAGCTCTGGGTCTAAGCTTTTAAGAAAAAAAAAAAATTGCACTACCCT
TCAGTAGGGGCAGCATTCACATCTCACACCCAGGCAGAAGCAGAAACGGCCAGGAATCCA
CCCCACTTTCTGGGCCTGACAAGGCCACAGTTTGAGAACGTTCAGCACAGGCCAAGCATC
AGATGGATTTTGAACATCTCTGGCTCCTACCATTTCTGCCTCCACCATCCCTTTACTCAC
TGTGCAAGCTACAAAAGCTGAGGGGACAGGAACAAGGATGATTTCTGATGGCATATTTAG
GTAAGAAGCCAACCCCCATGTGCATGGATCCAATGCTATCTGATAAAAGTGGCCTATTCC
TCAGCTGTTTTGAGCCTGCTTCCTCTGTACAAGGTCCTGGGAATTGCTCTTTTCTATACT
AATAATATGTGAGTCAATTGCTAACAGATGACATTTTAGATATATTTTTGGTTGGTTGTT
TTTGTTTCTTTTTTTTTTTTTTTAAGTTCCAGGGAACATGTGCAGGATGTGCAGGTTTGT
TACAGACATAAATATGTGCCATGATGGTTTGCGGCACCTGTCAACCCATCATCTAGGTGT
TAAGCCCAGCGTGCATTAGCTCTTTTCCCTAATGCTCTTCCCCACCCACCTTTCCCCGAC
AAGCCCCAGTGTGTGTTGTTCCCCTCCCTGTGTCCATGTGTTCTCACTGTTCAGCTCCCA
CTTATAAGTGAGAATATGCGGTGTTTGGTTTTCTGCTCCTGCGTTAGTTTGCTGAGGATA
TGTACTTCTGATAGGAGAGATTACTTTTGGCAAGCCATCTCATCTCTAAGGAGCCCCGTT
TTCTGAAAATTCAGATTGTTGGATCAGTTGCTCTCCCACTCTGTTTGAGTCCAACTGTCT
GAAAGTGCAGCCACGGGGCATGTGGGTGCTTTGGCATCACGTATCATAGAAATGAACCTA
GAGAATCTGATATAAAATCCCAAATGACATGCAGATCCAGACTGTCATTTACACCATGCT
GACTATTACGGAGACATTGCCAAACTCATTTTGAGACTCGTTACACAAAAATACCATGGC
GACCCAGCCTAGCAGGCATTGGGGGTGTGGAGGACATTTAGCAAAAGCAATGCAATAAAT
TACATGTGAAGTTTTAAAAAAATTCTTTAAAAATATAGGGTTGTCATTTGAAAGGCAGTT
AATTAGCTGGACTTAAGCTCTGACAGGAGAATTGTAATTGAAGGCACCAGCGTGTGTGAG
ACTGGGGACAGCTGAGGTTACACTGAAGACTGGAGAGTTTCTTTCTGCAATTTCTTTTCA
GACTGTATCAGAGGCAAACAAGGCCAAAAAAGAAAATGTAAAAAACAAACAAGATTTGAA
AAACAGTCAGTGAGATCATATTTCTATATTTTTGCAAAATTCTTCCAGGTACCCTGCAGC
ACAAAAGGCCATTGGTCATTTTCCTAGGGTCCCACACCACAGCCCAGTGGTTCTCAATCT
TGGCTACAAATTAGGATCATTTGGGAGGTTTCTAAAAAGTCTCTGAGTCAGGCAGGAACC
CAGACCAAAGACATTAAAATCTCTAGGGGTGAGATCCAGGAACCATTATTTTCTAAAAGC
TCCCCCGGTGATTCCAATAGATCACCAAGCAGGGCCTCCAGACCAGCAGTATTAGCACCA
CGTGGGAATGTGTTAGGAATGCAGATTCCCAGGCCCGCTCCAGTTCTACCAAATCAGAAA
CTCTGAAAATAGAGCCCAGCAATCTGCATTTTTTTTTGAGACAGAGTCTCGCTGTGTCAC
CCAGGCAGGAGTGCAATGGCACAATCTTGGCTCACTGCAACCTCCACCTCCTGGGTTCAA
GTGATTCTCCTGCCTCAGCCTCCCAAATAGCTGGGAATACAGGTGCCCGCCACCACGCCT
GTCTTATTTTTGTATTTTTAGTAGAGACGGGGTTTCAGTATGTTGGCCAGGCTGGTGTCA
AACTCCTGACATCAAGTGATCCACCTGCTTTGGCCTCCCAAAGTGCTGGGATTACAGGAG
CAATCTGCATTTTAACAAGGTCATTCTAAAGCATTCTAAAGAACAAGGCTGAGGATGGTT
TGGGCTTGGGAGGTTTTCAAAGCAGATGTTTTTGGTTGCTTCTTTGGACATAAGAAAGTC
CATCTGGATCTAAGTAACAAGCCTTCTCAGTGAACTCACTATTATGAATTAATTGCAGAT
GTAACTCTTAATTTGCTGTATGGATTTATCAGTTTTAAACCAATTAACTTGTGGATCTTC
AAATGTCGCCTGCCATAATTCTACCTTCACATGGTCATGAAGTTGGAAAGACTCTCTAAC
AGTGATTGGTGGCAGAATTATTTGCCAATTGTGATCATTCTGGGTTTTTGGAAATTACAT
CATAGTATCAGGTCCAGGTCTGTCTGTTTTCTGGGGCAGGGTTTTATGCATTCATAAGTG
GTTTCGGGTCATTTAAAAAGAAATGGTTGAGCGTTGAGTTTGGATCTGTTACCAAACAAT
TCCTGCCTACCCCGATGGTTAGAATGGGGCTAAATGCTAGTTTTGTACAAGAACAAGGAC
CTGAATCTCTTGAGCCCAGGCAGCTTAACCCCTGACAGATCTCTGCACAGACTCAAAAGC
CTAGAAACCAGGAAAGGCCACAAACAATCTTTGATTCTCATTCATGTCTGATCTCTCCAC
AACGTAGAGAAGACAGCTGCCATGGTCAGCCACAGGAAAGCCAAGCCTAAACCCCCAAAG
CCCCAAATCCTTGGGCAGCAATTTCTTAATGAGGTAGAAAAACCAATAAACTCCTACCCA
GGACCACTGAGTGTGCACCTGCCATGTGCCACATGCTGTCAGCCACTCTACACACCTGCT
CAGTGATTCAACAGCCCGCAAATGTCAGTGGTGTTTCTCGCTACTTTGGAAAGAAAAAAA
AAAAAAACTTGACTGAACAATTCTAAGGAAACTGTCCAGGATCATGTGGCCAGGAAGTAG
CAAAGCTAGAATCCAAACCTGTGGCGGCAGTGGAATCCCAAAATCTGAGCTCTTTCTGCT
CCTCACTCCTGCCTTCTGAGACTGTGGTTCAGGGTGGGAGATGACTGCCCTTCTGGAAAA
GGGAGTCAGTTAGAGCTTCGGAGACAGCTCATTGGCATCTGTTCATTGGAGTAAGCAGGT
TATAAAGAGTCAAGCCCCACTGGTCAAAAGGTATTAAGTTCTGGTGGCATCTATTCGATA
AACATTCATGGGCAGCTCCTGTGTGGTTGCGTGCCCAGCACCAGGCTGGATGGCAGGGCA
GGGATGGGATAAGGGGCCTGGAGATCCTGACCATGATGAGGTTAGCAGGGGTCATGGTGT
GCACAGTGCTGATCCAGCCCCATGTATCAGAGCAGGCTTCGGGAAGGAGGTGAGAGCTGG
GCTGAATTTTAAGCATGAGTAGGCATTGCTGAGAAGTTTCATGGGCCAAGAAGAAGGCGC
AGTCTGAGCTGGAGACGCACAATGTGTAGAGGCTCCGGGGCCAGCAGGGACCATGGAGCA
TAGGGTCTGGGCACAGTGGCAACAGTGGAATTGGAGAGGGATGCATAGACTCTCAAATTT
AGGGCCTGTATCCATGCAGAAGACCAGGAGTTTCACCCTGAAGGCAGGGAGGAGCCAAGG
AAGGCCTTCAAGATGGGAACTGCCATGATGAGATTGCAGTCATCAGTGAGAGTGATGCAG
ATTTTGGAGTGAGTGGTGTTGCCACTCAGCTCAATGAGGCAGGGGCCAGTCTCTGACAGG
ACAGGGTGGAGTGTTAACTTTAAGGAGCCTGGGGATGGCCAAAGGGAACCATCTCCTTAG
CAGGTCACTGGACGCATGGCTCTGGAGCTTAAAGAGAGCCCTGGGTCATGGCCATGCAGG
TGAGCCTGGAGCAGGTGCAGTCACCCTGGGAGAGAGGAGAGTAGGAAGAGAAGAGAGCAG
GTAACAGAACTCTGAGACACAGCCAGAGTTCAGAGATGGGTAGAGGAAGAGGGGCCTCGG
AAAGGTGCCAGATGTCTTCAGCTGGTGCTGGGTTCAGGGTATGTTTTACAATTAAACCAA
TTCAATGAAGAAATAGCTCTGGGTCTAAGCTGGAGAGGAGCTAGGTTTCTGAGGTTATTT
GTCCTACACAAGATGATGTGCAATGTCACAGTCCCCATCCTGGCTGGGAAAGACAGCGCC
GTCCCGGCAAGTGTTGGAATTTGTCTTTCCATAGCGATTCTGGCCATAAACTGTCTTCCC
AAATACATCCTTCACCTGTAGTTACAACAGTCCCCCCGAGGCCATGTTCTACTCCAGGCC
ATGTTCTACTCAGCTACTTTAAGCTCCTAAGAAGTGAGCAGGGGACAAGCAGGGTGGCTC
ATGCCTGTAATCCCAGCAATTTGGGGGGCCGAGGTGGGCGGATCCTGTAAGCCCAGGAGT
TCAAGACCAGCCTCGGCAACATAGGGCAACCTCACCTCTGCAAAAAATACGAAAATTAGC
CAGTCATGGTGGTGCATACCTATAGTCCCATCTACTCTGGAGGGTAGGGTAGGAGGATCA
CCTGAGTCCAGGAGGTTGAGGCTGCAGTGAGCCAAGATTGTGCCACTGTACTCCAGCCTG
AGTGACAAGAGTGAGACCCTGTCTCAATAAAACAGAAAAAGAAAGAACTGAGTGGGAGCA
CTTACGTGTGATAAGCTCCCAGTGGCCCCCTCTGGCTTGAGTTTGGAATGTGACATCAAC
AACTTGGCCTCGGAGCTTTTGTTTCCCAGCAGGAACTGGGGGTAGAGGCTGGCATTTGCT
CAAACCTAAATAAATAAATAAATAAATAAATAAAAACAAGACCTGTTTTTTTTCAGCTTA
CCAATGATCTCAAGGTCACCTAGATGGGGTTTCCACAGCAAACCAAACCCCTGACAGAAT
CTTACAGCTACTTGGAGACAATTTTTCCAATTCCCAGGCCCACTCTGAGTATACAGGGAC
AGTGATATCAAGATTAAACGATAGGGAAAATGTCACTTTCTGCATAGCCAGAGAGTAGTG
AATGGAAATAAAAGGCAATCCATGTACCATTGCTCAATCAAGAGAGGGCATTGTGTAGAC
CCAAGACGGCACATACCATGGACTAGGGAGCATGTGAGCTCACCCCTCTCACCTGAGGTT
TTAAGATTGTGTACGTGTGTGTGCCTGTGTGTGGGCAGGGAGGGAAAAACATAGCACAAG
CTACAACACTGGCCTCTTCGAGGGGAGCTCTCTGTGAAATCTCCCTAGACATTCTGAAGT
CCACCACGTGACAGCATAGATTTTTCATTCAGATGAATGTAACTGTTCATAGAGAGATGC
TCTGTGGTGAAACAGACCACCAATTGCACGTTGCTTCCAAGGGCAACCAGTCTGACTAGT
CTTGCATAAGCTGCCAGGAACTAGTTGTATGAGATGCGTGATTTTTTTTAGGTCCATAGG
AGGTCAAGGATGGGGATATTTGTCTCCCCCTTGTTTATGGAGTCAGCAGCCACAGCAGTG
TCCATCTCTGGGGGAGAAGGCAGAGAAAAGAAGTGGGTGTTCACCATGGGTTGTATACAA
ACATTGGAAGCAAGGGAATGCACACACCCAGCACCGCAAGTGAGCCACAAAAGCACAGTC
ATGAGGAAAAAGAAGGAGACTGAATGAGTTGGATGACCTGATACCATTTAGGTAAACCAA
AATGCACACATGCAACCCCATACGCCACAATATGCAGCAATGCATATTAAAGAAGCTCAT
TCTGATGGTCACCTATAGGGGTGGAGATTGGAGTGGTGGATGGAAATAGAAGGGAATCAA
TGTATCCATTCATCTATCAAGAGAAGGCATTGCACAGACCCAAGATGGCACATGCCATGG
CCTGTGGAGTGTCAGCTCACCCCTCTCACCTGAGATTTTAAAATTGTATACGTGTGTGTG
CGTACGTGTGGGTTTTGGCCAATACGTACTTTTTGATTTGGGGTTGCATTTTTCCTTTAA
GAGGTGTGCCTGGGAAGTTTGAGCTGCAGCAGTGGAACCTTAATGCCCAGGATGATCCTG
TCTAACACCACAGCGGTGACGCCCTTTCTGACCAAGCTGTGGCAGGAGACAGTTCAGCAG
GGTGGCAACATGTCGGGCCTGGCCCGCAGGTCCCCCCGCAGCAGTGACGGCAAGCTGGAG
GCCCTCTACGTCCTCATGGTACTGGGATTCTTCGGCTTCTTCACCCTGGGCATCATGCTG
AGCTACATCCGCTCCAAGAAGCTGGAGCACTCGAACGACCCATTCAACGTCTACATCGAG
TCCGATGCCTGGCAAGAGAAGGACAAGGCCTATGTCCAGGCCCGGGTCCTGGAGAGCTAC
AGGTCGTGCTATGTCGTTGAAAACCATCTGGCCATAGAACAACCCAACACACACCTTCCT
GAGACGAAGCCTTCCCCATGAACCCCACCACTGGCTAAAACTGGACACATCCTGCCTGGC
AACCTGATTTTCTAATCACATTCCTCTCATACTCTTTATTGTGATGGATACCACTGGATT
TCTTTTTGGCTGTTGTAAGGGGTGAGGGGTGGATTAATGACACTGTTTCACTGTTTCTCT
AAAATCACGTTCTTTTGTGATAGACTGTCAGTGGTTCCCCCATATCTGTCCCTGCCTTGC
TAAATTTAGCAGAATCCCTGAGGACATGGCCTCTGAGAATAGCAGCTGCATTTCCCAGAC
TCCCTTGCAGCTAGCAAGGTTGTGTGACTAAGCCCTGGCCAGTAGGCATGGAAGTGAAGA
CTGTAATGTCCAAGTAATCCTTGGAAAGAAAAGAACGTGCCCTTAACTAACTTTGTCCTG
CTTCCCAGTGGCTGGATGTGGAGGAGGTGGAGAGCAGTTATGAGACTGGGAAAGAACGGG
GCACTCAAAGAGCCACACACATCTGGGCCTGGGCGACGTGGATCCTCCTTACCACCCACC
AGGCCAGATTTACAGGAGAGAGAAATCCACTCCACTCTTCCTTAAGCCACTGTTATTCTG
ATCTCTGTTAAGGTCGCAGAATCAATGCCCTTACTGATACACCTACCTTATAGGACTGAA
CCTAAAGGCATGACATTTCCATACTTGTCACAAGCACACACTGATTCTGCCCTTGTCACT
TCTGTGCTCACTCTTGTGGCTCTATCCTCCTCCTGCCCTTCCGCCTTCCACTCCTCCCTT
GCACCCATCCTGCACACATCTCCCTGAAAACACACAGGCACATACACTCATATACATAGA
CACACATACACACCTCAATCTAGAAAGAACTTGCTTTGTACAGGGCTGAGATGGAGGAGA
AAAAAATGCCCCCTTCAGAATGCATACCAAGGGGAAGGTGCTCGGTCACTGTGGGAGCAG
GGAAAGGTGCCCCCACTCCCCGAGAGCCAGGGGAAGGAGTGGCTCTGGGCAGAGAGGGAC
ACATAGCACTGGGGTGGCAGGTCCTTTTGAGGTGATGGGCCGGTTTTGTGAGATGAATTG
TATCCCCCAAAAAGACAGGTACCTTCAATGTGACCTAATTGGGAAATAGAGTCTTTGCAG
ATGATCTAGTTGAGATGAGGTCATTGGGGTGGGCCCTCACCCAATATGACTGGAGTCCTT
ATCGGAAGAGGGAAATTCAGACACAGATGCATAGGGAGGACACCATGCCGTGACAGAGGC
AGAGGGTGCAGTGACACAGCCACAAACCAAGGAAGGCCGAGGATGGATGCGCATCCCCAT
CCCAAGAAGTCGGGAAGAAGCCAGGAAGGCTCCTCTCCCACAGGTTTCAGAGGAAGCACA
GCCCTGCTTGAATTCAAACTTTTGGCCTCCAGAACTGTGAGTCAGTACCTGTTGTTGAAG
CCACCCAGCTTAGGATACTCTGGCAGCCTACTGCCATACAGTATTGGGATACTATAGTGA
GCCCATGCAGCACCTCTCACCCACCCAGAGATGGAGCTGCTCTGCCTTCCAGCGGGGCAC
CCGGAGGGCTGCCCCAGCAGATAGAGAGGGCCTCCGTTCTGCCACCTGCCTTGAAAGGGT
CTCCAGCTGCCATATGTAGCATTGGAGTCCTCTGCAATGCGACATCCTGAAAGCTCAGCT
GCCTGGGCATTCCTGAAGAGTATGGAATATTTAAATGAAACATATTTTTTTAAAACCTGC
GCATAAGATAAAAGCAGCCCGTGTGCATCTTGGGCCATCCTCAAATGGACAGACTTGGTC
TTGTGAGGTTCCAGTCCTTGTTTCACATAATAAACACTGGCATGGCTCAGCCCCTGAGTT
ACCACAGTCCTTGAGATGAGTGGTTCTTTGGGTTACAAAGTCCTCTGAAAGTCTAGTGAG
AGCTGTGATCTTTGCCCCACCCGAATAATGCATATGGACACCACACCTTGCCTGCCGTGT
CCAGGATTCATGACCAGTAGCAGCCCAGCTATGCCTGCCACGTCTCATGGCCCCTGTGTA
AGCCAGACCCTTCTTAGGCAGTTGCATATTCCCAGACTGAGGCAGGGCAGGTTTGCAGAG
AGAGACCCAGAGTGCACGTGACCCGCAGTGTGATCCCTGGCACGCACTGACTTTGATATT
CCAGGCACACGGACTGGCTATTTATCACCACTTCTTTTTCCCCACTAAGATTCCTGTGCC
TTTTAAGGCAGAGGGAGATCCCTATGGCGTTAGTCTTCCCAGGCCTTAAAGGGCCCTTGT
CTTCACTCACAAACCTCTTATCTCTTCTTCTCCTTCCTCTACATTTTAAAGGGGGAGAGG
GAAAAGTAACCGGGAGACAAATTGAGCCACATATTTTCAGACACTTGTTACCATATTTTA
AAATCTGGCTTCACATACACAGAGTCTTTGCTATGCACCATGTACTGTTCTAAGCTTCTT
AAAAATAGAATCTCAATTATTATTTTGCAGGCAATACTCTATGCATTCATTAGCTAGGAC
AACAATGCATTTGCAGTAGTGAGATTTCGCTAAAAAATTAAAGCCATTTACTATGATCTG
TGATGTGTGTTCTTAATATCACTATGATACTTCTAGAAGATGGTTATCAGTTCTTACAAT
GCTTTGATGAGGCAGCCCCACGGACTTGGGAATAAGGAAAGTAAGATTGCATGTGGATAA
TTAAACTCTGCCATCAACACACAGCGTGTCAGAACAGAGAGATGTGGGTCCCTCTGATGT
CTGCAGATAGAAAGCAAGTGAAGCCCTAGGTGGAGACAATGGCGAACAGTGGCACCTCCT
GCCTTGTAAAGGGGAGGCTGCTGTCAACTCCTCGCATTTGCAGCCAGCAGCGAATATGGG
CACAGTCTAGACGGAGCAGGGAATGTGGACACCATCTAGACAGAGCAGGGAGTATGGGCA
CCGTCTGGATGGAGCAGGGAATGTGGGCACTGTCTAGACAGAGCAGGGAATGTGAGCACC
GTCCAGACAGAGCAGGGAATGTGGGCACCGTCCGGACGGAGCAGGGAATGTGGGCACTGT
CTAGACAGAGGAGGGAATGTGGGCACCGTCCAGATGGAGCAGGGAATGTGGGCACCATCT
GGACAGAGCAGGGAATGTGGGCACCGTCCGGACGGAGCAGGGAATGTGGGCACCGTCCGG
ACGGAGCAGGGAATGTGGGCACCGTCCGGATGGAGCAGGGAATGTGGGCACCGTCCGGAC
GGAGCAGGGAATGTGGGCACCATCTAGACAGAGCAGGGAATGTGGGCACTGTCTGGACGG
AGCAGGGAATGTGGGCACCATCTAGACACAGCAGGGAATGTGGGCACTGTCTGGACGGAG
CAGGAAATGTGGGCACCGTCCAGACACAGCAGGGAATGTGGGCACCTTCCGGACGGAGGA
GGGAATGTGGGCACTGTCCGGACAGATCAGGGAATGTGGGCACCGTCCAGACAGAGCAGG
GAATGTGGGCACCGTCTGGACAGAGCAGGGAATGTGGGCACCATCCAGATGGAGCAGGGA
ATGTAGGCACTGTCTGGACAGATCAGGGTATGTCGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 1869..1951, 10921..13915
10971..11357
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved