Homo_sapiens Locus RPL23
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPL23
Homo_sapiens
RPL23
17
SNORA21
1743..1874
5651
gcagaatgtaagctccataaggaaaagaatgttgatctattttgttctctgatgtaatc
cgctgtacgccctggacagaacctgctgtaaagtaggagctcaataagtatgtgaattaa
tgtatcgtgggaaggaaagaacccagagaataaggggcggctgaagctgtgaaaggagca
attaggcctggcgcgggggctcacgcctgtaatcccagcactttgagggaccaaggcggg
cagatcacttgagatcagaagttcgagaccagcctggccaataacatggcgaaaccccgt
ctctactaaaaatacaaaaattagcccagcgttgtggcgggcgcctgtggtctcaggtac
tctgaggctgagacagagaattgcttgaacccggaagacggaggttgcagtgagctgaga
tctcgccactatactccagcctgggcgacagagtgagactcggtctcaaaaaaagaaaaa
aagagtgtgtgttgggggggacgggtcaataaatagagcaatactgtatatgtaaaatac
agaatggtatgataccaagaacacatagatggaatgatctgcagcacttctcaactgtat
tacattcaacgaaaccgtttagagcttgttctccctccctcccccactttctttgttcct
tggggaacccccacacggcacaaaccgtgttttaattcctattctctagtgtgcagataa
gtgcctggcactattaagtggtcaaaagaggtcgtgagcaagttaacaaatcactgtttc
catgtccctaactactcttaagctcgtagagaagatacttcctatctcttgcgcttctac
ctcaactcccacttcgcagagagggctaaaagcgacgtcgtaaacttattacgtaataag
gcagcgcccagaggcggaagaggccggtttttgctccggccacgtgaggagggtgggcgg
ggcgttaaagttcatatcccagtgtcctttgaatcgacttccttttttcttttttccggc
gttcaagatgtcgaagcgaggtgaggttttgtttctggaggatcctccaccatctgtcgt
gcagtggctggcggattcgtcaggagcggtggccctaggcagctggggcgctttgctctc
cttcaggccggagagagagagccaggccaccgcgagagcactgccagggccctcgaaagt
ggcagtggggtgctggagagttgagatggcaggatcccgacgtgaatgtagtctggatac
cgcgagatcgctccgcgaatagggctatcgtaatggggttgaagttagactggattaggc
cctggtttgcgcgacctctgcggttttatgccttgcaggagtaattgcgttttgcgaaag
ttagagcaagggttgagtcgtctaggtttcttaatttcgatgtcagagtgttaatagtaa
gaaataggctactttccgtgagaatcgggtggcacatggggacggcataagtaaaatccg
agcgagctaatctatagcgtacagtctatcaaagcatgtgcggtgaattacagcttgagt
atgagggggaactccgaaccatgtctagattgtgatctctttatcctgtttcccttccct
ttatatccacaggacgtggtgggtcctctggtgcgaaattccggatttccttgggtcttc
cggtaggagctgtaatcaattgtgctgacaacacaggtgaggtctttgcacgttgctata
ctcccccttttaaaagcactcaatgggcctgtggctaatgacctattgagccgtcaagaa
aggggagagtgaaaacatcgcttttgggtgaagtggcaacatgtgttgtttgcttcaatc
ggtggtgtgacaaggcgttcttgcggactaactgcttgggcagtgagtggagggaggggc
tttggaagtgtttgggaaatgttatactgatggaacggcctgatggccctcaacattttt
tatttttatttacattcttttgtaggagccaaaaacctgtatatcatctccgtgaagggg
atcaagggacggctgaacagacttcccgctgctggtgtgggtgacatggtgatggccaca
gtcaagaaaggcaaaccagagctcagaaaaaagggtgagtaaacactgagcccaccttaa
tactgatgagtagtggggggacgctttcctttattggaaaatggatcagttttcaaggcc
tcaagtttgttttccattgagaggcagtgtgagataagtatcttaagtttttgctcatat
tgtgttggaggggggaccatcatcttgtcacttccataccttagttgtttttttgttgtt
gtttttgttttgttttgttttgttttttgagatggagtctctctctgtcgcccagcccat
actggagtgcaatggcacgatcttggctcactgcaacctccgcctcctgggctctcaaaa
aaaaatatattacaaaacgaaaacaagctgcccgttgcttattttattatttgtttttga
gatggagtctcacttgttgcccaggctggagtgcagtggcacatatctgttcactgcaac
ctccacctcccgggctcaagagattgtcctgcctcagcctcccgagtagctgggatcata
ggtgtgcaccaccacacccggctaattgctcattacttaatctcaggctccccactcaaa
atttttcctgtcaggtgtatgatttaaagggggaggcctcaaaatacttgcagcttgtgt
cctgtctggctttagaacttctggtgtttggtgcattttaacttcagcgcttgcactttt
ttcctgtgcctgcctaatctgtctctaccctgggatgtcttgctcttctaaagagttcct
ggccatcccttgatttacaaatgtgatgttgatttgtcagccctgtattacagttactcc
tattcctgtatccaccccacgatgctgtccagtagatttttagcctttgggttagaaatt
gttttttgttcaccattaatatccatttgagggctgggtagcactgtgattgtgattcag
caattgcatgggctttttcctcttctcagaacacttcctgggtctgattggtggcccagg
gagctgtcagagaagagcagagcaaatggccttcactttgtagatgagatggcaggaggg
tggattgttggtctcagtcagtggtgggacagaccagagctccgaacacttcagttttaa
aactagttgtgagtttccaattctgttaatgtcttttttggtccttgtttctgctaaatg
aatacatcccctccccttggaacttaatatcaataaataacaagcacagaaatatgcaaa
aggaccaggtctacttgaagaatttgtgaggattaaatggtttatgagtagaggagggtc
agtcagtaagtattggctacctcatgtgtgtcccattactaacttggttagacttatcta
ttttttgtgtagtcttcctgtcataaaaattctgtgtaaggaccccatgctagtatcagt
gaagattgtgaatccaggtgtgtctgactctacaatagttcttcacaagcattatatttc
actgtgtagtgatacttcattttgaaagttgggaaaagcgtctttttcactttagtacag
atgggtataaaagttacttaggacactagaaaacagttcattaaaagtaaaacaaagcct
ggtgcttgggcccaggaattcaaactgttttccagtgtaaatctgaatagcttggtctct
gctcattgccaggactgggaggagttgggggtcccaggtcccatttctacatcccaattc
agtgatactgggatcttaataacctacctgtaaggtgaagttggaaaaggcataggcaag
gatagttgtcctgagagttttacacttgtgagaaaatactggcagctttgattttaagat
gtgaatagatgatcgtggttcatgcctttactccctatactcccagcactttgggaggcc
aggcttgccaacatggcaaaaccctgtctctatgaaaaaaaaaaaaaaatctgggcatgg
tagtgtgcacctgtagtccaagatactagagaggctgaggtgggaggatcaccttgaaga
ttgatatttacactgtcactgtctcaaacgctgagtgtacattctgtctagttggaaact
gcttttgtggtggcactgcgacttgacaggttaatgactgctgtccttttttcttctctc
agtacatccagcagtggtcattcgacaacgaaagtcataccgtagaaaagatggcgtgtt
tctttattttgaagataatgcaggagtcatagtgaacaataaaggcgagatgaaaggtag
gaaatcagtccagcttgttccttaggtctctgaggttgggtggattgtctagaagtacag
gccaaggatcttctgtgtttgacgatgtcttaatctgtcccccacatgtttttattttat
tttattttatttttttaatgcaggttctgccattacaggaccagtagcaaaggagtgtgc
agacttgtggccccggattgcatccaatgctggcagcattgcatgattctccagtatatt
tgtaaaaaataaaaaaaaaaactaaacccattaaaaagtatttgtttgcagtgcttgtct
ccctgttcacttccagggttcaagcgattctcctgcctcagcctcctaagtagctgggat
tacaggcacctgccgtcatgcctggctagtttttgtatttttggtggagacagggtttca
ccatgtttgccaaacgactcaaactcctgatctcaagtgatctgcccacccaggcctcta
cagtgtttttgacataccctgaccatcacttttctgaaatggaaactctgggcatttttt
ttttaaagcaatccttgcttttttgtgagtttgcagactttcagcatcttccaattgctg
tatttacaattttggcctcaaaaagtattatttgggttttgagtcccaaaaataatagta
gatactgctcaatgactggctatacatggtagcttctcctggagtgaggaaggcattcaa
atggctgggcgcggtagctggcacctgtaatcccaacactttcggaggccaaggcaggca
gatcatgaggtcaggagttcaagaccaggctgaccaacgtggtgaaacctcctcttttct
aaaaatacaaaaattagctgggcgtggtggcgcaccgcctgtaatctcagctactgagag
aatcgcttgaacctgggaggtggagtttgcagcgagtcgagattgcaccattgtactcca
tccagcctgggcaacggagcaagattccgttcccgcccccgccccaaaaaaaggcattga
agttaagatagactatatagttagatcctggacacacacatggattttgaggaatgatgt
gagtttgtttatgtatgtacattttagcagttaacagatttggagtaaattgaatattta
taaaacaacagtaattgccatgtaggtttactgtcatagtggaagatgattaagttgatg
gtacctacaggtattttgctatgaaaatgttttgacaaacaggatgatcgtgtaatttat
gttccaagctct
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1632..1715, 2005..2133, 4262..4375, 4523..4651
1027..1039, 1632..1715, 2005..2133, 4262..4375, 4523..4605
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved