Homo_sapiens Locus C17orf45
snOPY snoRNA Orthological Gene Database
Homo_sapiens C17orf45
Homo_sapiens
C17orf45
17
SNORD49B, SNORD49A, SNORD65
1464..1535, 1995..2065, 3185..3257
4983
AGAAGAATCGCTTGAACCCGGGAGGCAGAGGTTGCGGTGAGCGGAGATCGCGCCATTGC
AGTCCAGCCTGGGCAACAGGAGCGAAATTCCGTCTCAAAAAAACACAAAAACGAGCAACA
ACAACAACAACAACAAAAACCCTACACTTATTTCTGAGGCCAGCTCAAAAGGTCTTATGA
TTGTCTTCCCAGTTTTTTGCAGTCAAAATGAATTTCTTTCCCTTGGTATAACGTGTGTGT
GCAAAACGTGGTTGCATGGATTCTTTTTCAAGGAGAGAGCTGAGCATGTTCATAGGCTGA
AAGGAAAGCCACAGTAGAGAGAGTTTTCCATGGAAGGTGAGGCAGGGGCATAGGTGGAGG
AGGCCCCAAGGAATGAGGAGAGGAAAGGAGGTGGGCAGAGCTTTACCCCAGAGGCGAGCA
GAGGATGGACGTGGATCTAGATAAGACGTCAGCTCGTTCCCTAAAGGTCGTGCTAAAGGA
GTAATGAGGGTGACCAGTGCGCAGGGGTTTGAGAAGCCCCGTGGATGTGGTGAAATAGCT
GTGGGGAGAGTATTTGGCAACGCTCAATAGATTCAGGAGGAGCTACTAGGATGAATGGCT
GCCTTGTGCCACAGCTCTACAGGCTTTCACGTGTGTCATCTCACGTGATCTTCTGGGGCG
CTGGTGTCTCCGTTTACTAGAGGACCAATCGGAAGCTTAAAGAGAATGAGTAATTGGCCC
AAGACCACCCAGCTAAGGAGTGGCGGAGGTGGGGCCCAAACGCGCGATCCAGCCCTCGCG
CAGGCGCCCTGGAACTCCCCGCGCGTGTTGTGACCCAGAATTCCCGGGGCTGTGGAAGAG
ACCATAGACTCAACAGGAGGGGGAGTCCTGGGTAGCGCGCCGGTCTAAATCGTTACTTGG
CGGAAAGTTCCCATGAGTCTTTGCCAGCGTCCCCCTCCTTTTGTGAGGATTGGGATATTC
CGACTCCTTAAGGGCCTGGCGCACATAAGGTGTGACCTTTTCATTCCCGTTGTTATGGAG
GTAGGCTCTCTAGGAATCTGGGAGTAGTAGCTGGGGGGCAAGAGCAAATAAAGAGCTCGA
GCTTCTGTGGTCTCTGGGGAGATGTTCCCGGGAAGCCTGTCTAGAGGGCGGAGGGCAGCT
GTTGAGATGGCGTGGCTCCCCGGCTCCTGCGCCCGCGTGGCTTTCGCGGCGGGCGCTGCG
GCCCGGTATTGGACAGCCTGGCAGGGCAGCGCGGGGCCGAATCCGGCTGCCGTGGCTGAG
GCTCATGGATCACTCTTTTGTGGTAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGG
CCGGGACCCGGTTCCCCGGCCCACAGTGGGGGTGTGCAAACCCGAGAGAACTGGGTAAGT
TGGGGTCGGCTTGCAGTTTGGGGTACCCCGAGGGCGGTGTACGTCGGTAAGATTGTAACA
GTATTACTGGAAGACTTATTCGACTGTCCTGATGATACTTGTAATAGGAAGTGCCGTCAG
AAGCGATAACTGACGACGTCTAATGTCTATCTGACCGCAGTCGCTGAAACCTCTACAACT
TAGTTGACCGTAACTGCCAGAGCCCTGCCCTGAATTCCTGTCCTTACTCCCTCTTTAAGA
TTGCGTACCCACTGCAGAGTGCTGAAGACGGGGTAGCCACGAGGTGAGAGGCTCTCTGGT
GTAGGGTTTAACATGGAACGTAGTTTTGTCACTTGAATGCACGGAAATTGGCGTTTTGAC
AGTTTTCTACGTTTAGGTGTTTTATACACTTTAGGGTAACGTTATCATGTCATTGCATAG
GGTGGAACTTAAATAGAAACTGGAGATGGCTGCTTCAGCCACAGTCCTAACCTAGAACTG
CATTTAAAGCAAACTGATAATGCAGAAACAAACTCCTTCGTTAAGAAATGTCTCCAGTAG
CAGGGTTAGCTTAAGTTTCAGGTAGGGTCTAGATCTGCGGTTGGAACAGTACTGGAGGGT
TGTGAGGTGCTTGACTGCTCTGATGAAATCACTAATAGGAAGTGCCGTCAGAAGCGATAA
CTGACGAAGACTACTCCTGTCTGATTGCAGTCAAGTCTTCACCACTTGCTGGTTCCCAGG
AGTAAACTTGTTTGAACGGTGACCTAATTGCTATATTCACCTAGGTTGCAAATTCGTGAA
GAATCAGCATCATGTTTGGCAGCTGAGTATTGGAGCCAGGAGCCTGCCATGAGGTAAGCC
TTGCTCTATGGGGAGGCTAGTGGCTGACCACGCCTAGCTGTCAGGTCGAATATTGGCAAT
TGGATTTGGTTAACCTAATACCTTGTAACAGTGTAGCCTATCCCAGAGATACTGATTTTA
GTTTCCGGTGGCAGTGGAGCCAGGGTGGATTACCTAGAAAGAGGGGCTACTCTATTTACC
TCTTGGCTGTTTAGTCTCGGGCAAATTACCTGTCTGCTGAGATGTAGTTTTCCTCAGATG
TGAAAAGGAAAAGTAATCTTAGCTTTGTGAAGTTTAAATTGATATGACTGAAATGGAGAT
TACAACTCCCCTGAGGCTGGGCACAGTGGCCTGTAATCCCAGCACTTTGGGAGGCTAAGG
TGGGTGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCTGGCCGACATGGTGAAAC
CCCATCTCTACCAAAAATACAAAAATTAGCCGGGTGTGGTGGCGTGTACTTGTAATCCCA
GCTACTTTGGGGGCTGAGCCAGGAGAATCGCTTGAACCCGGGAGGCGGAGGTTGTAGTGA
GTCGAAATCGTGCCACTGCACTCCAGCCTGGGCAACAGCGAGACTCCATCTCAAAAAAAA
AAAAAAAATTACAACCTACTGAGAAGCTAATTAAGATTTGTAGTCCTCAATAATTTACAA
AAACTTAGAAAAATTACCTCTAATTAGGTCTTAAGGGGCTTTTGTTAGGATGGACTTAAA
TTTGTAAAGTCATTAATTGACTGTCATCAGAAATGCCTGTCCTGCTCTGCATCTGCAGTC
TCTAAGGTGTATGCGCCTTCTCCATTCCCCCAGGTTTTGAGAACAGAGTGCTGTTTTAGA
GCTGGCAGCAGCATCTCAGCCCAAGAGAAGGTAAGCCTTGAGCTGGCCAATGATCCCTTC
AACCCCATAGTGGAATGAATAAACAGCTGATCTTGTTAAAACTCGCTTCAAAAAAAAAAG
ATATCAAATGATGAAATCACCCAAAATAGCTGGAATTACCGGCAGATTGTGTAGTGGTGA
ACCTATGGTTTTCTGAAGATATCTCTTACCCTGTGATTGACTGTCAGTTGGTGCAGAAAG
TGAGATTGAAATGTAGTTTCTTTGCAGGTTATATTCCCAGAGGATGTCAGTCCCAAGGAC
CAGTAGCTGCCATCAGTTTGGATTCTGAAAACTAACTGGCATCAACACTGGGTGTAGAAA
CATGCTTGCCTTATGTATCAGAGGACATGCTCAGCAGATCCAAGAGATATATTTGGCAAC
TTTTTCTAGAAAAGGCACATTGGGTATCATTCATTACATTCTTGAGTTTTTTTGGGTTTT
TTTTTTTTTTTTTGAGACAGTCTTGCTGTATTGCCCAGGCTGGAGTGTGGTGGCACAATC
ACAGCTCATTGCATCCTCAATCACCCAGGCCTAAGCAATCCTCCCACCTTGTAGCTGGGA
CTACAGCTCACAGCACACCTGGCTAAAATTTTTTTTTTGTTGAGACGGATTCTCTATGTT
GCCCAGGCTGGTCTCAGGCTCCTGGGCTCAGATGGTCCTCCTGCCTCAGCTTCCAAAGGC
ACAGGCCAAGTTGTAGCTTTGTCCCTTGCCATCATGCCCAACAAGAGGTTCTATACCTTT
TAATGAATTGACTTTCATAAATTGGTTATGTTGGTGGGCAAAGTTCTTTAAGCTGGAAAT
TGTAAATTCCTCCTGAAATGTTTTTTCATGCAGTTACCATGAACTAATACTACAATAAAG
GATGGTCTTGGGTGTCAATTCTTGAAAATGTGTATTTGAAGAAAAAGTAAATTTCGCCTA
CTGTTGTCAGATATTAGCAGTCCAGATATTCGCTCTAGCTTGTAAACTTCCCTGTGGTCA
GCCTAAGCTCTTAACCCCCTATTCTACAGCTTTAGACTGAAGGCAAAAGCTCAAAGCATT
TAAGGCCTCCTCAATTTCGGCCCCTGCTGCTCTGTGCTCTGTTCCTTGGTGTAGCTTTGT
TCCAGCTCCTGCAGCATTGCACCATTCCTAACCACAACCTTAACAGCATGTAGGGCCCCA
TACTCTAGGCCCCATCTTGCTGTCTTCCTGTGTTGGAATCTTGCCTACCAAGGCCTGTCA
AGAGGGTCCTCCCCCATACTGTTTGCCCACAAGGTTCAAGAGTGATTGGCTCCCAGTCTT
CCTGGACTGAACTACTTGGATCTAGGGGTTGCCTGTTATTTAGAAGAGATCCCTTAACTG
GTAGGGCCCTTTCAGTAGGACAGTATTTGGGTAAGGGGAGGGTATAAGATGAGAACCTTT
GCTAAGTTAGGTTCCTTTGGGAGCCTCCAGTTTGTTTCTCCCTCTCCCCAGCCATCTTGT
TGGATCTGCCAAGGGATTGGACTCCTTCATTGTCCTAGGTTTTTAAGGTTTTAAAGCCCA
CCTTCTGCAGTCGGTTTTCTGGAATGTGTTGGTGGATTACTTAAGAGTTATGGGGAAAGA
GTTCTTACGGCCTGTCTAGGTCAGTGAAGTCATACTGGCAAGTGACAAGAAGGAAGCCAG
GTTTGTCACTTACCCTGCATGCTAAGGACATCAGAGCCCACATAGAAGTCTGGTAGTTTT
TCAGCCAGCAGTGGGTAGGGAAGGTGGATAGGGGATTTCTGAACAGGACTTTATGCCTGT
ATGCATGGGCACCATGTCTGTCCTGAGCACTACCACATGGCATCGTAGGCTGCTCTGTCA
AAGGATATAGCGATAGCTGGTCCTATGGGCAGATGCCTAGAATCAAGGTGGGCCTCAGAA
ATAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1373, 1619..1662, 2144..2212, 3033..3089, 3327..3983
1101..1373, 1619..1662, 2144..2212, 3033..3036
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved