Homo_sapiens Locus RPL3
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPL3
Homo_sapiens
RPL3
22
SNORD43, SNORD83A, SNORD83B
1512..1573, 5318..5412, 6714..6806
8742
ggggccaggcgcggtggctcacacctgtaatcccagcactttgggaggccgaggcgggc
ggatcacgagatcaggagttcaagaccagcctggccaacatggtgaaacaccgtctccac
taaaaatacaaaaaaaaaaaaaaaaaaaattagccaggcatggtggcgcattcctgtaat
cccagctactcgggaggctgaggcaggagaactgcttgaactgggaaccggtaggcggag
cttgcagtgagctgagatcgcgccactgcgacagagcgagactccgtctcaaaaaagaga
tttgtaagggaccagcctggaagcagggaatcggtcaggatccgagtcaccctggagcct
aggcagagatcagcgaaagccctcgctgatgcataggtctggaaggcgtggggctccggg
aggctgagcagctggactcggcatgaccagaggtcgtgaggccgttccgcaggcttggga
cgctcctgaccctcagaatcaagcgcgggccactgcattagcatgggagaaatggcagag
atagggcttgagggagggatgcccgagattaaaggtattaaaggtaaattggtgtcgccg
caaaaccagcgtgggagccaggaaacgagagtttcagtctttcttcgctaattccagaga
tagctgcatatcacaggaggagaagcgacgcagccatttttcttcgttattatcaaattt
ggctgctgccggacgccgtagatttgtggctcacccacccttagcccacctctccgcggc
ttttcactaagtttgaacccgacccctcgccgtagagtgtgtaatttctgtctccgaagc
tgacgtcaacttctgaacgaaagctaggagcggaagagcgtgcgtggaaatggcgctcgg
tacgtgcccccgacctgtcgtctgccgcgggggcgcgctcgcacgccggaaggggcgggg
ccagatttggctttatatagcggacccgtaaggccgaccggCCTCTACCGGCGGGATTTG
ATGGCGTGATGgtatgtgttgtaatggcggccgtttcattgtcaccggcgtcggcacggc
tgaatccgcgacgcatcgccgccatcccgtcttggccggcgccgggggtttgctttaggg
gcacgggcgacccagcggggacttcagtctggcctattttctggaaagtcgagaggcttg
tgaagagcgcttggaggactggctttgggcctgcaggtcggccagagagaggccgtaagg
gtgggagcaggcttggaggcccggcgtttttaaagccatgagtcatttctaagtttcgac
ctcaccaattctatcattagttgggattagggcccataacctgcttgtctgggtagaagg
accttgggtggaggttctcggcgccgttctcattgggaggtaaagaagcttgggggaggg
gagtgttgtggagtcctcctgaatatctggggccgctggtgcactccgaaggcctctgga
gctcgcagaaaccacagatgatgaacttattgacgggcggacagaaactgtgtgctgatt
gtcacgttctgatttggctctgcggagttctttggcctgtgtgtatcagtgtaattagtg
tccgggcaccggaggcagcctatagcttaacattgctagctgctacccagcgtttgtccc
gggagtccctttctttagcggtcaaaaccttgctaattggcatataaagctgcctgttaa
gcagtttttagtgccactacttagtgtatttttgtgtggttagataaaaaaaatgggtcg
ttttcttacaggttgagaggatttgaaataagattcagcttaaattttgtcgaatacaaa
agcattcttgacacgtgcgagcctggaagagataatgacctttttattcggcttgctggg
tgtctggtcaggattcttcagtattgctgagatttggaacttaagcagctgggaactaga
gaagggggcactgctttggtttgggtgctgacggtgatttttttcccacctagTCTCACA
GAAAGTTCTCCGCTCCCAGACATGGGTCCCTCGGCTTCCTGCCTCGGAAGCGCAGCAGCA
GGCATCGTGGGAAGGTGAAGAGCTTCCCTAAGGATGACCCGTCCAAGCCGGTCCACCTCA
CAGCCTTCCTGGGATACAAGGCTGGCATGACTCACATCGTGCGGGAAGTCGACAGGCCGG
GATCCAgtatgtacagacatcctaaaagttgggggaataggagtggagggggagggaaat
tgtagagatggagtcaagctgttagcagagggcagacttttttttttaagcaggagttac
acgttgtcagaactgctgcgacagcagaatgggaatgcttaacttgaaaactaatattcc
aaggctacagatggtcagcactgtttgctttaggtgcggtgtggggtattgatttcagag
catagtaaatttgccaggaaccttagcaaagagaagttaacactagtgtggggggttgga
gctgctgaggctggcataagaactgcctcattcatgtttttttcacctgaaagcttgaat
aatggccacttacctgtgtgtgttctacttagagatgtctaacagcactggttgctgagc
catggagacattaatgttaggcagttgatactgactaatctctgagctcagagctattgt
tagggcactgaattttccagataaatagcaatcttgtctgcctccagaggtttctgtaga
agagaattgaagctggacaggtatttggctgtctagggtcctgatattttttgtttgaat
aacataaatgtgctttgaatgagagataggcagtaaggacagccctgtgagtccgtactg
caggtgtggggcccagttgcccttccggcctaaatgggcactttgcattttcctagaaaa
cattacaccccttgcttgggctcctgccaagtctgactactgctttttttttgcagAGGT
GAACAAGAAGGAGGTGGTGGAGGCTGTGACCATTGTAGAGACACCACCCATGGTGGTTGT
GGGCATTGTGGGCTACGTGGAAACCCCTCGAGGCCTCCGGACCTTCAAGACTGTCTTTGC
TGAGCACATCAGTGATGAATGCAAGAGGCGTTTCTATAAGAATTGgtaagggaggaggcc
atgcagtccctagcttgggagcttgggagctggagagcagggagcagcgtgtgcatggtt
tctcagctctgtagcaggcagggagctgctgtcttgggtttagtttgcctctcgaacaga
aaaatacctgggatcagacttggccagccatctggtttcagccggaagctaacaccctca
ttctgagtccaggctagtgggtggtggctgaggacccagttggttgaggagtccaactag
aaaccaggagaggtagcagaataattaaacccctataggggtggcaagggcctctggccc
tgggtggaatgtcccatttccttcatcactgagtgggcttccccagggcagaaaggtttg
tcccggagcaagaattttgtttgaatgcgtgtaacttaaattaaccttgtggacctctgc
tcagctccgctcggctctgcccgatgagctccatccaggctccgcttgctggtggaaaag
gctccttagaagccggcaatgagctccatccccacgcggtgccagtgtgccttccgctca
cccctcggaggggtgatgaaggcctgcacctggtcccctccccaactctgctctgctcct
gaagGCATAAATCTAAGAAGAAGGCCTTTACCAAGTACTGCAAGAAATGGCAGGATGAGG
ATGGCAAGAAGCAGCTGGAGAAGGACTTCAGCAGCATGAAGAAGTACTGCCAAGTCATCC
GTGTCATTGCCCACACCCAGgtgagcccagtgccccggggtggcttggcctgccacttag
tagaagtgacctatgtgatcatgggggtcccgtgcccgcacgcttatgggtaggcttctc
ccttgccagcagagggcactgtgtccttactggcccttagcaagggaaccattccccttt
aaaattcaactggtgactcaccagtaacactgaaatgcctgcctgaaagtcggttgtgag
gtactggctgctctcctggaaacctagttgatgagctgagcaggctttttattgacttgg
ttagagtgggtgcctcttgctgtcctgttactggttatcctggctgatctcaagtgctga
gtgcaaccccatgtggtgagggccaccacggatgagagtgcatgtccaccgttgaaattt
tgtcaggacattgccaggctgtccttgagtgaaagctttatgcttaaatgcatttttttt
tttttagagacagaatttcgttcttgttgcccaggctagagtgcaatagccctatctcag
ctcactgcaacctccactttctaggttcaagctattctcctgcctcagcctcctgagtag
ctgggattacaggcatgcgccaccacgccctactaattttgtatttttagtagagacggg
gtttctccatgttggtcaggctggttttgaactcctgacctcaggtgatccacctgcctc
ggcctcccaaagtgctgggattacaggtgtgagccaccgctcccggtgatgcattttctt
acttagagcttgtgctctctcaaaagcaggcttgtcactagggcaagtgtaggtggctga
ggtaaaaccactgcagtaccccaaaaggaactgacccaaaggacagccacaggaacattg
ggctggtaggggctgggatctggttgtttgcctgtggtgtgggtcttgtccgctcatcct
gacagtaactcaggcaccagtatccaaagttaagttgttgctgttggcaaaaatgaaagt
tccttcctcttggtgaggttcagtgacttgttcagagttactggctttttgccgtgtgct
tgacatcaatcaggccgcatggagctgcagttcctctgctgtgggaggagcgctggcagc
tggagctgagctgtgtctaccttctcctagATGCGCCTGCTTCCTCTGCGCCAGAAGAAG
GCCCACCTGATGGAGATCCAGGTGAACGGAGGCACTGTGGCCGAGAAGCTGGACTGGGCC
CGCGAGAGGCTTGAGCAGCAGGTACCTGTGAACCAAGTGTTTGGGCAGGATGAGATGATC
GACGTCATCGGGGTGACCAAGGGCAAAGGCTACAAAGgtgagctttgcggtggcttgagt
tgctgtgcaaacctgggggagaagtggtttcaggcccagctgttcgttgatgaggctcag
agtgagcgctgggtacagcgcccgaatcggacagtgtagaaccattctctactgccttcc
ttctgagaacagccttgtggtcagaagtggctgggatagcggagggccaggggacaactt
cttaacacgttcctggaccctttgctctttgtagcctactgataactgcaaaggggagct
tggaattatgttagtcagtccctgtgaatgggggagcttaaactaatggatgccttaaaa
agcacccattcagaattgagttcagggtgacacccccagagcctatccagcttgacaggg
gagacctgtgggtaatgcacatgaaataatcttatcactccctcagatgacccagccatg
gttggtaattgctgagtagcaggaaggggtcagtgggaggtgctgggcgctgaggtgaag
taatgtgtatccattccagGGGTCACCAGTCGTTGGCACACCAAGAAGCTGCCCCGCAAG
ACCCACCGAGGCCTGCGCAAGGTGGCCTGTATTGGGGCATGGCATCCTGCTCGTGTAGCC
TTCTCTGTGGCACGCGCTGGGCAGAAAGGCTACCATCACCGCACTGAGATCAACAAGAAG
gtgaggttctgagagtggctccctgggggtgggaagaggcccccgtgatggggagtgggg
tttctgtgcctgtcagtgctgcttcactgactgtagcttatgcatcacgtggacatcagt
ggcttgcttctcatggtcagttctggcccatcttgatgatttgtaaggtgccatcctgta
gagtggctgtggtggggctgactggtgtggctggggatactagtcttattggtccctgat
gccaccaccaggggggtgacaggcctgtgttgtacagcaggatctttagttttagcccag
ccgccttacagaaaggaacctggagggccagccagctttttgctctgaccttgggatacg
ctgtgactgggactgaggcctcagctgccttctagcgtgctttgcaggtcagcacactgg
catgtctgggttatttgtccctaatgccccagccttacacccttcttgttcattcagATT
TATAAGATTGGCCAGGGCTACCTTATCAAGGACGGCAAGCTGATCAAGAACAATGCCTCC
ACTGACTATGACCTATCTGACAAGAGCATCAACCCTCTGgtaagtaatgggtgttctgct
ctgtgaggccatcccaggcctcgtgcttttggggataggctgcttcctaggggctgctag
caggatcgttaactgaagccaacacaacacctagctgtgtcccttgtaagtggcatgttg
tcatctgagtccactcgtcggggttggctggtgagaagtggggtctcaggctcagctgtt
cagtgatgaggcctggaatgtgcgctgggcacagcgcccgagacagactgcggaaccgtt
ccttgttgccttccttctgagaacagccctgtggtcagggagggcctgaacctggagggg
tcatctgcacgacaatcccctcctgggcctgtgctgatccgatgctcgttttccagGGTG
GCTTTGTCCACTATGGTGAAGTGACCAATGACTTTGTCATGCTGAAAGGCTGTGTGGTGG
GAACCAAGAAGCGGGTGCTCACCCTCCGCAAGgtgaggcaggtcctgacttgtcatgggg
gggctcttgtagagggaggatccaaggccacagacgctggtggccctgtggtgggagagg
aaaggaaggagagggtgttggcagtcctttcacactggctttgaagtcctgagatgagga
aattcccagtctggccttgctgggctgtttgctgctttgagtgtgtcctcatctgccgga
tggtgggggaggctgaattgatcgtgtggcttcccagatgcaggggcgctgtgaacagtg
ctgaggaaagcctggctcctcgtaatcctaaatcccttcccctcttggcccatagTCCTT
GCTGGTGCAGACGAAGCGGCGGGCTCTGGAGAAGATTGACCTTAAGTTCATTGACACCAC
CTCCAAGTTTGGCCATGGCCGCTTCCAGACCATGGAGGAGAAGAAAGCATTCATGgtgag
cacctctgcctgcccccctcgctgggtgtggtggcttgggcagccgcctgcctttggctc
cagccggggtaggggtggtcttgatgccttaggcctctcttgtggctgtggagactggcc
cagagtcttggtctcctctagagtgggcatctgctgtcacctgtcatcttctacctctga
ccactgcctctctccccacagGGACCACTGAAGAAAGACCGAATTGCAAAGGAAGAAGGA
GCTTAATGCCAGGAACAGATTTTGCAGTTGGTGGGGTCTCAATAAAAGTTATTTTCCACT
GACatcttgcctctttcttcaggagagaggctgggactggggaggcagatgggggccctt
gaggtgccttgtgctccccaaggccactgccctcctttctgtagcttcgctgggtttgcc
ttctggcctcccactctgtcccccaccctcagtccctggagggaggtaaaagctgggcct
ggttctgcagctgagctgtagaaatccagcctggagcagtgggcattgtgcaaatgtttg
tcaccagggtgaggcagctgggtctctgctgtttgcacagcttgggtgatgccagtgctg
tggagacgagaaggagacagggaggcctggatgttccctggcgcgtttgatgctggtgtg
caggcagaccgtgggtttgttacttgtttaaaaagttcatttggttttaaattaatccag
ggaagggtggcttccagttaaggcttgttcaggttcttttgtaatctgcaccccaagtct
ggtactgggagaacatgaacacaggcacagaggttaagggacttccccggctcggcagct
ggaagcctagttggaacatgtggcagagggctgtgtcccctctgggctggggtctacctt
ctgggacttggctggtgcagtccctgttcccactggagatggcccctgtaccccagcccc
ctcgggcatgggacttatgtgctttcttgacttgcacgttgagtgcctgctgccctcagt
ccctggagcccaggatgctggggtgcagctgctgctgtaagctgaaggaagcccccaggc
tctggactgacccctgtgacctggcctggagcccggtgatctcggtgaagcccagcacag
accctggtgcttggacccacttgctgactccccgtctttgctcaagctgcacctaggctc
taccaggacggggtgtggaatgcaggtcccctgatgctgtcgaagctgctccctcagact
caaggtgctgtggctgtgagcaggcgctgtgctgtactccatc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 2033..2225, 2996..3164, 3784..3919, 5070..5256, 5779..5939, 6417..6518, 6896..6991, 7315..7434, 7641..7742
1028..1030, 2033..2225, 2996..3164, 3784..3919, 5070..5256, 5779..5939, 6417..6518, 6896..6991, 7315..7434, 7641..7685
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved