Homo_sapiens Locus RPL10
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPL10
Homo_sapiens
RPL10
X
SNORA70
2905..3039
4540
ggtgcgctcgagcaggatttcctcccgtccttcctgtcaaaggacgggaagactttgtt
accccaccgcgccccacctgcagaatggtggacagatacctccagatgccacttccccca
ggacgcccgcctgctctgcgcacctctccccggatgctgccccgtgggcgggtgggggcg
gccctgcttccccacgacccccagacgcacccggaggggactcttgagcacagtggagtg
ggaagggcgaggtggggcggtgcccaggcgagagcggctcatgggaggcggcgcccgaga
cgcagctggtcgggacggtgcgggtcagggtgggcggacggggctagagatgccccgggg
tttcccaggccatgagtctccgtggagatttctcctcgacctcttccccgcggcaatgtg
cgaaccctgggtctccaggaaacggggatacggggcatggctcccagcaaggcctggtcc
agcctctccggtaggggaatgggtctccccctccggcctcccgggttgacaaaggaacgc
gggcccagatccccgtatggcgcttcaccgccggggcctctagcctagaaggaggcacgg
agcgcgtgtccgagacccgtgcaagctcagggacactctcgcggtcgccgggaggcccac
ctagggtactttccttttttccactctcagaaatatacgtctgtcacagttaacggcaaa
gcctagggcaagagttctacgcccaagatggccagccggaagcgggcttctcgcgaccat
gtggcgaagccccattcgtcagctggccgcccgcggccctggtacccggtcacctctctg
atctgcgcatgtgctgggctacgcccgggcgcaaggccaagagcggctgcgtctatggtc
atgacgtctgacagagcgtccacccgtcttcgacaggactctatggttcttacgcgcgca
gacagaccgcctatataagccatgcgcaggcggaggagcgcCTCTTTCCCTTCGGTGTGg
tgagtaagcgcagttgtcgtctcttgcggtgccgttgctggttctcacaccttttaggtc
tgttctcgtcttccgttccgactctctctttttcgttgcagCCACTGAAGATCCTGGTGT
CGCCATGGGCCGCCGCCCCGCCCGTTGgtgagtcttgaatccgtgtactttcactgctgg
gaaacgggcggggaaagaagtgcctatggcccgctgaaaacaattgtggggtggagcctc
ccccgtgcggcggccctgtcttgggaactgaccctatgttttacacctcccggctatttt
ttagtctgcaatattactgtctgttccttcgttcccgtgtcggtgtggaagcgacggttc
cctcgtatctctgcctgtgtcctgcaagctcaccgcattttcgggcgctagatacgctct
tggggcctttgtgtgcgttctctgtcttatttccgggcgacgtgccgcgtgcgttgtcgg
acgtgaagggcagtccgggaaaaacgggtgcggccgcctcctgtgtcctacagggggcgc
cagacgcatttccactcggcttggaggtggatttagtgccacgtgcccgaaagtcttaaa
ttgggtgacctgagctgtgcaatgataatgcggcgattttgtagtacgcagtgtcttgaa
gagagaatttttaactaggaaagtttgttgcaaagtgtttataggaagcgtaagacaaag
taacggaagatggtgtctgttgtttctagtcttgggtgttgtctgtgttgcagcagccaa
ctgttgctttgtagtttatttccccgaatggaaacggtttagaagtggacgtgcattccc
cacccttttcccgtccctcgtttgggttgttccttgaggggcaaagtgcctgttgggctt
tctgtgaacctcacctaacctgtgttttttcactcccctgcagTTACCGGTATTGTAAGA
ACAAGCCGTACCCAAAGTCTCGCTTCTGCCGAGGTGTCCCTGgtaagtagtggaagagcc
cctgcactggttggctctgcggactccgcgtccgtctgtgacaccccctgcacacttacc
caatccttttagATGCCAAGATTCGCATTTTTGACCTGGGGCGGAAAAAGGCAAAAGTGG
ATGAGTTTCCGCTTTGTGGCCACATGGTGTCAGATGAATATGAGCAGCTGTCCTCTGAAG
gtaaggcaggattctttgttcgtcaccccccagtccttcctccgtgctccctcaacccca
cccacatacactgcactggaattgggagttgatgaaacatgagccttacaaaactcagcc
aacacagttcccctgagctggagatagtcgtggtgaatgtttctctattatcttctctca
ctttgctgcttttcttctccctacctagCCCTGGAGGCTGCCCGAATTTGTGCCAATAAG
TACATGGTAAAAAGTTGTGGCAAAGATGGCTTCCATATCCGGGTGCGGCTCCACCCCTTC
CACGTCATCCGCATCAACAAGATGTTGTCCTGTGCTGGGGCTGACAGgtgagcttggtct
gggccttttaaggcagttggagtctctacattattaggcttgcattattttatcagagca
tagaggtggccccagtgactcagccactatggctactagaaaagccaggctggcaagtga
ctttcagtggtcactcaggaccccttcctgcagatacaaacaaagcatgagtaagtctta
gcaagctcttccccacaggttaggggaaacactggtgatgggagtagctcttcttgcttt
tagctgaatgacaaccatcttgccagcaggtagctgaagctggcagaggagcccagtggc
gccttttcagtggttcttgggatctccgcagccaattaagccgactgagttcctttcctc
atggggacccagtgtgcgatggctgcacacagcagcttccttggtagtgtacgcagcctg
ttggttgtatgggttgctctaagggaccttggagacaggcctttcaggtggatgttcatg
tttctgaccttgcactaccccaatgtagGCTCCAAACAGGCATGCGAGGTGCCTTTGGAA
AGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATCATGTCCATCCGCACCA
AGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTGCGCAGGGCCAAGTTCAAGTTTCCTG
GCCGCCAGAAGgtatgtagtgctgcagcccccttctcccacctttgccccaggcctcctg
actcagttctttccattgctccttagATCCACATCTCAAAGAAGTGGGGCTTCACCAAGT
TCAATGCTGATGAATTTGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTG
GGGTCAAGTACATCCCCAGTCGTGGCCCTCTGGACAAGTGGCGGGCCCTGCACTCATGAG
GGCTTCCAATGTGCTGCCCCCCTCTTAATACTCACCAATAAATTCTACTTCCTGTCCACC
Tatgtctttgtatctacattcttgacggggaaggaacttcctctgggaacctttgggtca
ttgccctttcacttcagaaacaggttgacaactcagccctgctcatgaggcagcaaaccc
tgcaaagggctgggactggtggccttatgtcagttgtctactctggagcttgacttggac
ctccccaggtcctaggcagtaggttgaaaaacactgaagtgcttttcatgaagcacagct
gcagcaaagccttgcaatcccaggctggggtcagcctacagttgtgttgcttattacaac
acatgcggaccaagaggggcttgtgggctagaggctgaccagcagcgtttatttagcaag
ggtaggtgtgcatcacattgggcttgttctcacccatctggtttggccattcctccttgg
tgggaatcatccaggtactgctgaggtcacctgcgatttgccccatttcctatctctagc
aacctcctgggccccatgcccccaccccttctagaacctgcattcccagggccttcacca
cctgaccaaaggtctaggctaacctttggtcatttgtaacaagacctcggaacagacacg
tgtgtggcatggtttggcctggggatcttagatgtctgacctgaactattgtagaacagc
gctggcttttgggggagcagcaaaaatgagaggagtgctaggtgggtggcctgagcatct
gtatccagggacaggactccaaaggcttttggtcccagagctggggtatgttggccccag
cccccagcctgtggctcccaaaaggcctctggttttttgtaatctcagtttacagccatt
tcttaggtttttaattacctttattttattttgccaaacatacctgggaataccttttat
tttttttttaccttggggtgatggttccaaaccataaatgtgattatagttaacacatga
cccttctagcgtcccagccagtgtttttcctgacctctctt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1121..1166, 1963..2021, 2112..2219, 2428..2566, 3088..3250, 3326..3540
1144..1166, 1963..2021, 2112..2219, 2428..2566, 3088..3250, 3326..3478
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved