Homo_sapiens Locus RPL39
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPL39
Homo_sapiens
RPL39
X
SNORA69
5160..5291
7138
gctggagtgcagtggcgcaatctcggctcgctgcaacctccgccttcagggttcaagag
attctcttgtctcagcccccgcagtagctgagattacaggcgcccgccaccacgcctggt
tagtttttttgtatttttagtagggacggggtttcaccatgttggccaggctggtctcga
actcctcgtttcaagtaatccgcccgcctaggcctcccaaagtgctgggattacaagcgt
gagccaccacgcccagcttatttttatgtttattttatttactcatcaaaaaggaaaggt
ttttgcttttaaatggggaaaaggatgaaaatggggaacactagcatcccaaacgcatgt
tattaattattgtacatcttgccaaaggcgggctacaatgtcaggctggacttctagcag
ccaaggaagaggttctgtccctaactttctgagttgaaaactttgattggcaaccttccg
cctagtcgaaaacccctaggcttacataagcgtccacgtggtccaaccccctccaacttc
tccggcttcctccgacacgactgtcccttcccacacctcccagccaggccgaaatgactc
gtaaccctctgggaaaatggcacttactctccgcctgccgagctccgacccggcgttccg
agtccccggcgcccggaggtgacggtcgcttcccctgccctcccttagggttagtcccgc
ccaatcggctccttaatttttcggaggggcttctactttggcatttatcacgggctgtct
gcctcacttacgaagcagggtgcccctagcacactgccgggcccctgggggaacgcactt
agggaagcgaagcaaagctaactgcatttggcagaaaccagcgcgctttcccacggcgcc
acgggagcgcaccgctagacagagaaggcactagaagaggcggtcggtgcatagcgtcac
ctcctaaactccgcccatcggaagcgccttctaagctcgttCTTCCGCCAGCTTCCCTCC
TCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGgtaagtcca
tcggcccccatcggccccggggtggcttcccaaaacccgaggccgctgccaggaaatgcc
tgggccgcgcggagcgttgaggggcgggagccttttaaaggctttttcaagaaaatatcc
agttcggccactgttgtctttcgtggcctggagggaagctagtgagccagcgagcaacct
ggagagggacgggctgcgctgcggccgcggattcaagggggctctttctttgcccggccg
ctgccgagtcgggcagggattccggtttcccttcgcttgtagcgaactcgttctggaggc
ggggggtgggaggtggcagccacccccgaaatcgtggcctgactgtgggctgcccgtggc
atgcgcaacgtggagggtaatcaggagggtattgtgggctactggttttcgaaaagggtt
tagcttggcgtggagaagcgaaccgcatttttagatcccaggacttttgtttagaggacg
tttattcagagacttgagcgtcaccccgtggaagcgcctagaacaaggggtgttttgcga
acctgtgtgtcattctggccttcttagtaaatggcagcagcgaaccagtcactctttact
gggaaatgtaaaatgttgatttctagatatggaggcgataagtactggtattttattact
tgtcaagtaatttattacttgacaaaatttacaactgctactgtggatgggggacggggt
gtaatctttgccttctttgtattggctcccattattatgcaagggtatgttcgtccaggt
tggccaggcattaaacctgcatccgtgccaattttgcaagattattctgtagatttgggg
gagtattggggttggccttagatgaaagccaaaagatgcaactagaaattgagacagtca
tccttggaaaagtgacatttcatttatttttaaatttaaaagtttatttttttagccagt
gaaatttagcagtagagatagagttaggattaataccgaaatggtgagtaggttagatct
tctgaatgtcagggactttccctaagtcttaattaccctcccaataacacttgaaaagta
cgtacccctgttttacaaagtagagcactgagattcgttgacttgcaaatggtaggtagg
tggttctgtttgactcaaagctgtgttcttcccaggaagccagattccctagccattccc
agtgtggtcgtctgagtccttgggggaccacagggtaaattgaaaggtagcctctggctg
tggagcagaaaggacctgggtttgaatcctggttctgcacattgatgctctgattttgtg
catgtttcttaaccggattccacttattttatctgaacgatggaaactgtggtatctgcc
cccagagaagttgtgagggtcagagacttgcttggcttgatggcttagcattgagaagat
tttggggctggggtatgtgttaagcactcaaatgttggtttgaaggagttcttgactttg
aatcattcgggcaggctctaatattgtctaaattgattgcattttcttcccagTCTTCTC
ACAAGACTTTCAGGATTAAGCGATTCCTGGCCAAGAAACAAAAGCAAAATCGTCCCATTC
CCCAGTGGATTCGGATGAAAACTGGAAATAAAATCAGgtaagacctccatcatactgctt
gtattttgctaaatgtaagagccactgtgtctggccagggttactttttgagtataaata
catgattaaaattgcatgcaatccaatccaccctttgacagcattctcaaattcgttttt
aaaaacgtacttcctttgtttctgcactgcatccagcccacatctgggcttatgggcaga
taattctccaatacttattaatttcctggtcatcttcagtctgagctaggtcataaggtg
gaaggctgtcttatacacatcctggtggggaagacccagtcagtatttttaggctttttg
tttttgtttttgtttttgtttttgttttgagacggagtctcgctctgttacccgggctgg
agtgcagtggcacaatctcggctcactgcaacctctgcctcccaggttcaagtgattctt
ttgcctccgccttcagagtagctgggactacaggcgtgcgtcaccacgcccagctaagtt
ttatatttttagtagagatggtatttcactatattggccaggctggtctcaaactcctga
gctcaagtgatctgcccctctcggcttcccaaagtgctgggattacaggcataagccatt
gtgcccggcctttgtttttgttttttgagacaggatcttgttctgttttacatgctgcgt
tgacactatctccctgcaacctctccctacctaccagactcaagtgaccctcccacctca
tctctctgagtagctgggactacaggcacacgccaccacacctggctaatttttaaattt
tttgtagagatggggtctctctgtgttgcccaagctggtcttgaactcctgagctcaagc
aatcctcctgtctcaccctaccaaagtgcagagattacaggcgtgagccatcacacctag
cccagtcttttagatgtttctcttttctaaaaagagactagaaaagattggaaaactgtc
ctctactgcagaagtagttgatctcaaaggaaaaacattactagaattgctatgaaggac
ctccaaggtcatctagactaactccagggaaagctaggcctgaaacagtctcctgcatgg
ctttttcagcccatcgctctttggtcctgatgggccttgagacaggttttgaagggagca
tcaagaatcagcaagagttgcccaaggttcagcagtcgctctctcacccaggctgagtgc
agtggtgtaaccctcccacctcagcctcctcctgagtagctgggactacaggcgttcacc
accatgcctggctaatttgtgtacctgttgtagagatggggtttcgccatgttgcccagg
ctagtcaaagcactttctcttttttttttttttgagatggagttttgctctcattgccca
ggctggagtgcaatggtgtgatcttggcttaccgcaacctctgcctcccaagttcaagcg
attctcttgctcagcctcccaagtagctgggattacaggtgcctgccaccacacctggct
aatttttgtatttttagtagagacggggtttcaccatcttggccaggctggtcttgaact
cctgacctcgtgattcacgcgcctctgcctcccaacatgctgggattacaggcatgagcc
accgcgcccagccagaacttgattcgacttgtatggcaaagctagtgggattggtttgct
aagaagacttaaaggggtggcttcttagggctaaagttgagggcctatttccttggttca
tttagctagttagatgtgaaaattgccacccattgtaatgttatgggctagttaattgct
taccatttgtttactggatactagacactgtcctttattatttgatacatctacttgaac
gtgggtttctctgtgtcctgcctgatggtgggacctgcttgtgaagagtgaaagaagtat
atataaaccaggcacagtgcttcatacttataatcccagcactttgggagaggccaacgc
aggaggattgcttgaggccaggaatttgagaccagcctgggcaacatagggagaccaccc
ccgtccatctctaccaaaaatataaattagctggacttggtggcacgtgcttgtagtcct
aactatttagcaggctgaagtgggaggatcacttgagcccaggaattcacaggctgcagt
gagctgtgatccggccgctgcattgtagcctgggcaacagtgtgaccctgtctcaaaaaa
agaaaaatgtatgtaaaactcaacgcctagttcaataaataacctgctattaaactctgt
ggtctcctagaattgggaaggtattttgtacgtaagattatatacccttgacccagataa
ttgacccaatggaatgattttcattgttttagctatcttccagcgttaaaaatgtttttg
aaagcaggttgcaattacagtgcttcattttgtggaagtactgccattatcctgctgaaa
gaaaagccgtgttaatcatttttgattttgcctttatgagggtaaaatcatgacagattg
acatggacaattctgggattgctgtttccctgcactagacgtgaatggaggagttgatcg
attgtaaagatcatgcgaggccaggtgcagtggctcatgcctgtaatctcaactctttgg
gaggacgaggcgggtggatctcgaagtccagccagttcgagaccagcctggccaacatgg
tgaaaccctgcctctactaaaaatacaaaaatacaaaaattagctgggtggtgttggggg
ggcgggcgactctgtctcaaaaaaaatatcatgcgggagcttttatatgtttgtgaccca
ttatgagggggttcagagtatgtctgtgtacctccaggtccattgaatcaaaagtgggta
caagtacacttggagagagtgggcttcgccactactctgatcctagttaagagcctagcc
ttcaaattattttgagaggataaaacttgacttggctagtttttaaacacatagggaatt
attttttttactctccagaaagaactccaaacttgttagaggagagaaaagcagtaccct
ttgtattttgtggtacctaaaaggttatgtgaatgggaacagctacattgctgtcagact
gcctttgtaacttgacatttttttctgtgtagGTACAACTCCAAAAGGAGACATTGGAGA
AGAACCAAGCTGGGTCTATAAGGAATTGCACATGAGATGGCACACATATTTATGCTGTCT
GAAGGTCACGATCATGTTACCATATCAAGCTGAAAATGTCACCACTATCTGGAGATTTCG
ACGTGTTTTCCTCTCTGAATCTGTTATGAACACGTTGGTTGGCTGGATTCAGTAATAAAT
ATGTAAGGCCTTTCTTTTTaattgctgttgtattgtggtttgtcaattactgaattctcc
cttccctgccaaacctaataacaacactatccagtagaactttctgcaatgatagaaatg
ttctctggctaccatgtgcttgaagtgtgtttagtgtaaaggactgattctgtaaatttt
attttatttttttttaatgtatttatttattttgagacagagtctggctctgttgcccag
gctggagtgcagtggtgcgatcttagctcactgcaacctccacctcccgggttcaagcaa
ttctcttgcctcagcctcctgagtagctgggattacaggcgccccccaccacatccagct
aatttttgtatttttagtagagatggggtttcacaatgttggtcaggctggtctcgaact
cctgaccttgagatccacccacctcggcctccccaaagtgttgggattacaggcatgagc
caccacgcccggcctcacatgagttttacaattaatcaactcccccattcacgtctagtg
cagggaaatagcaatcgcagaattttatttttagtagagatggggtttcaccatgttggc
caggctggtctggacctcctgacctcaggtggtccaccacctctgcctcccaaagtgctg
ggattacaggcctgagccaccgcgtccagccatctgctgcctgtttttgtacagtctgtg
aactatatggttcctacatttttaaatagttgaaagaatattttatgccatctgaaaatt
gaaatacaaatttctgtccatataaaatgttcttgtttcacagccatatgcataacttac
gtattatgtatataaatgcacccttgtgcacagagataatgtggcctgcaaagcctaaaa
tatttactactttgctctttatgcaaaaagattgcccacccctgttcctggattcaagcg
agttcacttgtttaaaaaaaatctaggttaattgttgacattgtaacaggtaatgctat
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 2633..2736, 5912..6138
1068..1070, 2633..2736, 5912..5960
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved