Homo_sapiens Locus TRO
snOPY snoRNA Orthological Gene Database
Homo_sapiens TRO
Homo_sapiens
TRO
X
SNORA11D-1
7495..7623
12621
TGAGAATATTATATATTCTATTGGATAAAATATTCCGTAGGTCCTTTTTGTCTAAAGTG
TATTTCAAGTTCAATGTTTCCCTATCGATTTTCTGTCTGGATGATCTGTGAATTGTTGAA
GATGGGGTCTTGAAGTCTCCTACCATTATTGTATTGCAGTCTACTTCTCCCTTCAGATCT
ATTAATATTTGTTTTATATATTTAGGTGCTTCTATGTTGGGTGCATATATTAAATATGTT
TATAATTATTCGATATTCACGATGAATTTATCTCATTATCATTATATAATGACCTTTAAG
ATCTTTTATGGTTTTTGACTTTAAGTCTATTTTATTTGACATATGTGTAGTTATCCTTGC
TCTCTTTTGAATGATTGATGGAATAGATAAATGTCATGAATTGTTTTCTGCATGGGGGCA
CAGTGCACCATGTCACAAGAGACAGTCTAAGTACAAACTGATATTGTTAAAACATCAATA
TAGTCATTGTGGGATCAATAAAAACTTTTCATAGATTTTTATACATTACTGTTTTTATTC
TGAATTGCATAAGATGGACGGGCACCCTATCTTTTAGTGTTTAGAACCTCTAAATGTTTT
AATGTGGTAACACTTGAAAAACAGAAATGAATATGACCTAGTCCCCTGCTCCAGAGCAGC
TCTAGGGAAGAGAGACATAGACACAAGGTATAACAACACTATGTAAATAGTGTTGGGATA
GAGGGTCTGTAGGAAGGGTTGGTGTGGGAGTTCAGAGAACTACATTCCTCCTAGGGGAAA
CAGGAGAATCAAATAGGAACGGAGATACAGAGTGGGGAATAGAGAAGTCAAATGGAGAAT
AAGAGGGAGTGATAACTGAATAGGGGTAGTAAGAAGAAAAAGGGAGCTACATTGAGGAGA
ATGGAAAGTTGAAAGTAGGTATGGAGGGGAGGAGACTGACAGGCAGGAACGGAGACCCCC
CTCTGGAGGCGGAAAGAGGCAGGACCACTTCCGGCCAGGGAGGGGGATAGGCTCAGACAC
AAGGAGAGGCTTGGAGAGAGCAGACGCCTTCTGGATTCAAGAAGACGAGGTGAGCTGAGG
TACCTGGCTTTAGTGAAGACCCTGTGGGGGCTTCCTGGCTGCGGCTTCGACGTGCCTGAC
TCCACACGCCCCTAAGGTTTGAAGAAAACCTGCTGGAGGTTTGGGACCTAACCGCATCAA
AGTCGCCTTTAGCGGTGCCTGGACCCAGTTCGCACGGGAGGAAGTAGGAGGCAGAATCCC
CTTTGGGCCACAGAAAGTAACGATCTGGACTCGGTTCGGGCCGTGAAAGGGAGGGATGCA
GACCTAGTTGGGACCGCAGAAAGGAAGGATCGAGAAATCCTTCAGACGGTAGCAAGAGGG
GAGGAGGATACACACAGTTCGGGAGGGAGATAGGAGACGGCAGGACTCCGTTTAGGCTGG
AGAAAGGGGGCAGTACCCCGTTTGGGCCACAGAATGGAGGGATCGGGACCCAGAGATAAG
AGTGGGCAGCATCCCTTTTGAGCAACGGAAAGGACCAGACTCAGACAGGAGAAAGGAGGG
GATATGACCCGGTTGGTTCCGGTTTGAAAGGGAAGAGACAGGACCTGGTAGGGTTTGAGA
ACAGGAATACACAGAAGGTTCATACAGTTGGATTTGGGGGTGAGGTATTCATGTTGCAGA
AAGGGCGGAGCTGCACACTTGCAGACGTGGAAAGAGGGGGGAGTGGTGTTGGTTGGGGAA
GGGGTGGTGCAGAGACGTACCGCAGAGCGGAGGGAGGGGGCTTATTAAAGGAAGGGAAGA
TGAAGAGAAATGCTGCAGAGCGGAGGGAGGGGGGTGTATTGGGAAGGGGCGGTGCGTGGC
AGTACCGCAGAGGAGAGATGGGCGGTGTTGGGGTAGGGGCGGTGCGGAGTGGTACTGCAG
AGCGGAGGGAGGGGGCTAGTGTTGGGGGAAGGGTTGGATCGAGATGTGATGCAGTTAGAA
AGAGTGGGTCGGGGTGGCGCCAAGATGTTCTGTTGCTCTGAGAGCAGGGGGCAGATGTGG
GATTGAGCTGGTTAGAAACTGTCCGGTTTACCAAGGCGCATGCGCGCGGAGGGCATTGAA
GAATGGTTCTTTTGGGATAGAGGTGGGCCTAAGATGGGGGGTGGGGGCGCCTCTAGTCGG
TGCGCATGCGCACTATCGAGTTGCGGAGGGGGCGTGTAAAGGGGTGGGGTCGTAGAACTG
ACTCTCTCGGAGGCAAAAGGAGCTGGGCCTTGGAAACCAGATGGCCTGGGTTTTTTAGGT
ATGAAAACCCAGGAGTTGAAGGGATTAGGGCCCAAGGTTACATGAGACTCCCCTAAGTCA
GGATAGGTGAGATGTCTGATGAATCTCCCCCTCCCTCTCATTCTCTAACTCAGGCCCATT
CCCCTCAGGCTCACCTGTTACTCGGCCTCCCAGAAAGATGGATAGGAGAAATGACTACGG
ATATAGGGTGCCTCTATTTCAGGTGAGGCCTCTCTGCATTCTCTCTAGGCCATCTGCCCC
ATCCTGAGTTCACTTACTGCTCTTCAGACCCCTTCCACCGTGTAGTTTCATAATTCCCTG
CCTAACTCGTCTCAGTCCTCCCTTACATGGTGAAGGAGAGGAGAGGAAAACCTGCCTGAC
TCTATTCCTTCCTTGCTCCCTACCCCATTTTAATTAACCACTGCTCAGAGGAAGGGAAGG
CCTTTGTGGAAAGGGATGGGCTTTAGCGAGGCCAAATGGCCCAGAGGATGGTAATCCTAA
GTGTGTAGGGCCCTCTGCCTCCCCCGGGGAGCCTGGGGCTTCCCTTCCCTCCAGATATAC
AGACTGAGACCACAGAAGAGGACAGTGTCCTGCTGATGCATACCCTGTTGGCGGCAACCA
AGGACTCCCTGGCCATGGACCCACCAGTTGTCAACCGGCCTAAGAAAAGCAAGACCAAGA
AGGCCCCTATAAAGACTATTACTAAGGCTGCACCTGCTGCCCCTCCAGTCCCAGCTGCCA
ATGAGATTGCCACCAACAAGCCCAAAATAACTTGGCAGGCTTTAAACCTGCCAGTCATTA
CCCAGATCAGCCAGGCTTTACCTACCACTGAGGTAACCAATACTCAGGCTTCTTCAGTCA
CTGCTCAGCCTAAGAAAGCCAACAAGATGAAGAGAGTTACTGCCAAGGCAGCCCAAGGCT
CCCAATCCCCAACTGGCCATGAGGGTGGCACTATACAGCTGAAGTCACCCTTGCAGGTCC
TAAAGCTACCAGTCATCTCACAGAATATTCACGCTCCAATTGCCAATGAGTCAGCCAGTT
CCCAAGCCTTGATAACCTCTATCAAGCCTAAGAAAGCTTCCAAGGCTAAGAAGGCTGCAA
ATAAGGCCATAGCTAGTGCCACCGAGGTCTCGCTGGCTGCAACTGCCACCCATACAGCTA
CCACCCAAGGCCAAATTACCAATGAGACAGCCAGTATCCACACCACAGCAGCCTCCATCC
GAACCAAGAAAGCCTCCAAAGCCAGGAAGACAATTGCTAAGGTCATAAATACTGACACTG
AGCATATAGAGGCTCTAAATGTCACTGACGCAGCTACCAGGCAGATTGAGGCCTCAGTAG
TGGCTATCAGGCCCAAAAAATCCAAGGGCAAGAAGGCTGCCAGCAGGGGCCCAAATTCTG
TCTCTGAGATCTCTGAGGCCCCACTTGCCACTCAGATAGTCACAAACCAAGCCCTGGCAG
CCACCCTGCGGGTCAAGAGAGGGTCTAGGGCTCGGAAGGCTGCCACTAAGGCTCGGGCAA
CTGAAAGCCAGACTCCAAATGCTGACCAAGGGGCCCAGGCCAAGATAGCCTCTGCTCAGA
CCAACGTAAGTGCCCTTGAGACTCAGGTTGCTGCTGCTGTCCAGGCCCTGGCAGATGACT
ATCTGGCTCAGTTGAGCCTGGAGCCCACAACCAGGACCCGGGGCAAAAGAAACCGAAAGG
TGAGATCTCTGACATTGCCATCCTTAACTTTGTGCTTCTTTTCCATTTCTACCCTTCTAG
TTTGTTCATTTCTTCTATAAAAGTTTTACTTTGAGCTAGTCCCTGTGTTCAGATAGGCTG
TGGAAGATGCTGAGAAGAAGGTGATATAGTTTCTGCTCCCTAGCAGTTCACAGATTGGTG
AGGAAATAAGACATCCATACACTCAGCTACAACCTGTATGTAATACTACTTGTATTTAAA
TAGTAGTTACCACGTGCCAGGCTTTGTGTTGGGTACAGTTACACAGGGTATGTCTGAATG
TCTTGAAAGTAACTCTTACCAACAAGGGATCATAGGTCCCAGTTTTACACTTAAGAAAAC
TGAGTCTCAGAGAAATGAAGTGACTTGTCCAAGAGGTACCAGCCAGCATAATTGGTGGTA
GCCAGAGGAAGAGAAAGACCCTTAGGCTCTTATCTTGAGTTGTTCCTGGCCTGGCAGAGG
AACGAAACTCCTTCCTGGAAGACAGTGAAAGATAAGCTCAGGACTCAGGGTGGCCAATGG
CAAGGTCAGGATCAGGCTCCACTACAGCAAGGCTGAGGGAGGGGGTTAGAGGGACTTTCT
GTCTGGAGCAGGCAAGGTGAGGAGACAGAGCCATCTCTTTCACCTGGTGACTCTGGACCT
TCCTTCTTTCTGATGATGAAGTCCAAGCATCTGAATGGGGATGAGAGAAGTGGCAGTAAT
TACAGGCGGATCCCATGGGGCCGGAGGCCTGCACCACCGCGAGATGTGGCCATTTTACAA
GAAAGGGTAAGAATCCAATGCTGTCCAGTCTCTTCTCTTCTTCACTTGCCCTCTTCTCTG
CCTCCTTCCAAGTTTTCTGCAAGCATGTTAAGATCTCTCCATCTATTCCTCTCCTCCCAG
GCTAATAAGTTGGTGAAATACCTGTTGGTTAAGGACCAGACAAAGATCCCCATCAAACGC
TCAGGTAGTGTCCTACCAACCCTCCTCCTTGAGCTCTCCTCTCCACTCCCCTCTCCTCCC
ATAGTCTGGGAGTAACACTTTATGGCCTCTTTGTTCTGTCATATCTCCACACCTGCCCTC
CTTGCACTCTGCCATGGCTGGCATCTCCCATTAACTCACTTCAGGTCTCTGATTGCACTG
ACCCAACAGGACTGGCAAAAGGGCTGCAGCTCTGTGGCCCCTGCTAAGCTCAGCTACTCT
CACCTCTCCTTTTCTACAGACATGCTGAGGGATGTCATCCAAGAATATGATGAATATTTC
CCAGAAATCATTGAACGAGCAAGCTACACTCTGGAGAAGGTGAAGGGGCAGTGCTGGCGG
ATGGGCGCAATGGGGAAGCTTTGAATCGAGCAAAGACATACATGTCCCTTTTGGAGAGAA
TCACAGAAACATGCTAATCCAGCCCCATTACTGTGTGAATGGGCAGACAGTGGCCTAGGG
AGAGGTGTAGATTTGCCATGGGTCACACAGCATGTCAGTGATGAAAACATGGCTAGGACA
GAAGCCACTCAAATTAGTCTCAGCTTCTATTCATAGTTGGACATATTCTGCATGTATTTC
AGATCTCACCTCTCCCTTGTATCCCCATTTTCTGTCTCCCTAGATTCCTGCTCATCACAA
AGATGATGTTGATGACAATAGTACATTTGCTGTGTGTTTACTGGGTGCCAGGCACTTGGC
TATGTGCTTTATGTGCATTATCTCACTGACTTCTTACACATGCAGACCCCCTAAGTACAC
TGGGAGTTTTAGGATGCCCGGAAAGTTCACTGATACCTAAGCTGAATTTTGTGATCTCAC
AGGCTATTCTTTTACTTGGCAGATGTTTCGAGTCAATCTGAAAGAAATTGATAAGCAAAG
TAGCTTGTATATTCTCATCAGCACTCAGGAATCCTCTGCAGGCATACTGGGAACGTAAGC
TGGGAAAGGGCTGGAGTGGGAAGGAAGCTTCTGCTTTTATCTGTGCTGCTACCCCTTCTT
TGTCCTACTTCCCCCATCCTCTTAGAGAGTCAGGAAAAACAGGGTCTCAAAAGCCCTGTC
TCAGCACCTGCACATAGTTGGAGCCCTGCTCACAGTAGTGGCACCTGATTATGATTGACT
GAAGGGTATAGGAGCCTAGGGTGGGACATTCCTGCTGTCAGGTTTGCTGTCTCTGTAGAA
GCTTCCCAGGAAAGCAGGCCTGTCATTGCTTGCCTCTTCCGATGGAGTGCCTGGCCTGGC
TTTGACAGAGTGGTTCTCAAGGAGGGCTTCCTGGTGTGGCTGGATCAGTATGCATGAAGC
GCAAGAGTGTCAGTGGGGCTGAAGGTTCTGGGAGAGAAAGAAGGGACTCACATTGACTGA
GTGCTTGTGTTGTACCAGGTTGACAGCCATTCTTCCATCTTCTTGGCAACCTGAGGAAGG
GAGAATATGATTTTCCCATTTTACTGAATAATAGACCAAGGCTTGCAAGGTCTAAGTGCC
TTGCCCAGGGTGGCATAGAGCTGGAAGCAGAGACTGGGCAGAATTCTGTATCTGAGGAAT
CTGGGAGAGGTTAGCCTGGTGAGCTGGCTGGTGTATCTTTTGCGGATGGCTGCTGAAACA
TAAACCTTCTTTCTGTCCTGTTGAAACATAAACCTTCTTTCTGTCCTGTTATTCCCTTAG
GACCAAGGACACACCCAAGCTGGGTCTCCTCATGGTGATTCTGAGTGTCATTTTTATGAA
TGGCAACAAGGCCAGTGAGGGTGAGTGGCTGGGCATGCAGCTGAATGGGCGGCCATGGTC
TGGATTCCATGTGTTCAATTTCTGTCCCTGTCTCCTCTTGCCTCCCCTCACAGCTGTCAT
CTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGGGTATGACTGGGCTCTCTCAGCGCT
TGCTGTCCGTGTTGTCCTTTGGCAAGAGAGGATGGTCCTAGGATTGCATCAGTCTGGTGG
TCTGGTGGAGCGGGTGGGGTGCTGGACTGGGTAGAGGGCCCAGGGTTCTGACCTGGGTGG
ATGACGGGCAAATGGTCCTGAACTCTCTGCTGTCTCTCTCCTTAATGTCCTCTGTCTGTT
CTAAGCTGAGATGTTAGATAGACCTTCAGGGATCCCTGACAAAGAGGCATCTGGTCTTAA
CTGCTTGCTTCTAGTGGCCATGTGCTCATTACTTTCTTCACTTCATTGAGACTGCCCCAT
GTGCTAGAGAGGTCTCTTCCATGTTGGGAAATGCCTCTGCCCTCATCTGGGCAGTTCTGA
TCTGTGTTCATGGGTTATTTTTCCCATTGTCAGGGTGAGGCATTCACTCTTTGGGGAAGT
GAGGAAGCTCATCACAGACGAGTTTGTGAAGCAGAAGTAAGTGGTGTTTGGGGCTTTGTC
TGGCCCTGAAGTGTTCTGGGTATACTGATCTGGTTCAGAAAGTGCTTAGTCAGTGCCTTT
CTTATACTAGCTTTAGAGGGATGGGCATCCTGTGTCCTAGAACTGATACTGTCTAAAATT
CCCATGGGCAGACCTTTCCAGGACTGGGCCAGACTCAACACAAGGCCCTTGCAGTGGGGT
GCGCTCAGAGCAGAGGGCCTTAAGAATGGCTCCTCTGTTTACAACACACCCAACAGGAAT
CTGGGCTTACTCCTCACAGGTGGCATGATACTTTGGCCTTCCTGTGACATCATGCCCTAT
ACATGTCTCCCCTGGAGAAGCCCAAGGGACTGCTTTGCACAGGGCCAGTGGGAAATGGCT
CAGTATTGGAGGCCAAGACCATAAACTGTGTTTGGTAGTGAGTCTGGGGCTGGAGGGTCT
TAGAAATCCCTCTCCAGGGGCTGTTTGTATTTGTTTGGAGGAGGTTGCCACCTGGTGTCT
AGTGCTTAGACAGCAGGGTTGCTTGGTTAGAAACAAGTTTCATTTCCTTTTTCCAAGGTA
CCTGGAGTACAAGAGGGTCCCTAACAGCAGACCACCTGAATATGAGTTCTTCTGGGGCTT
GCGCTCCTACCACGAGACTAGCAAGATGAAAGTCCTCAAGTTTGCATGCAGGGTAAGAGG
AGAGCTGCCCGAGCTTGGCATATTAAGGCAATGGGATACCCTTGGCTGGGGCAGGCAATG
CACAGGGATGGGCAGGTACAGAGCAGCCTGCAGCTCATATATAAACATGTGGAGCCTCCT
TTATGTCCCAGGGTGCTGCTAGATATATAGTTTACATCATCTCATTCATTCTTCATACTT
TGTATTAATCAGCATGGGCTGCCATAACAAAATACCATAGACTGGGTGGATTAAAAAACA
AATTTATTTTCTCATAGTTCTTGAGGGCGAGAATCCTAGGTCAGGGTCCACGAGGGTCAG
TTCCTGTTGAAGGCTCTCTTCCTGGCTTGCAGATGGCTGCCTTCTTGCTGTGTCCTCACA
TGGCTTTGTGTGTGAGAGAGAAGAGAGCAAGCTTTCTGGTGTCTCTTCTTATAAGGACAC
TAATCCTGTTGATCAGGACCCCACCCTTATGGCCTCATTTAACCTTAATTATCTCCATAA
AGGCCCTATCTCCAAGTACAATCACACTGGGTGTTAGGGATTCAACATACGAATTTGGGG
GCGGGCACAACCCTTCAGTTCATAACATATTTACGCTCTATCATTTCCTGTAATTATAAA
GACACTTAGGCTAAGTGAGGTTAAGTAACTTGTCCAAGGTCATATAGCACGTAAGTCAGC
AGAGCTGAAACTGGAGTTCAGAACTGACCCATGATAGAGCCCCAATAACTGAGAAGTTTA
AAAAAGTATTGCTACTAGTTTAATACAAAGCCCGTAGGTTAATACATGATTACTAGGGTT
GTTTTCTTATTATGATTATCATCCCCATTTCAGGTGCAGAAGAAAGACCCCAAGGACTGG
GCTGTGCAGTACCGCGAGGCAGTGGAGATGGAAGTCCAAGCTGCAGCTGTGGCTGTGGCT
GAGGCTGAAGCCAGGGCTGAGGCAAGAGCCCAAATGGGGATTGGAGAGGAAGCTGTGGCT
GGGCCCTGGAATTGGGATGACATGGATATCGACTGCCTAACAAGGGAAGAGTTAGGCGAT
GATGCTCAGGCCTGGAGCAGATTTTCATTTGAAATTGAGGCCAGAGCCCAAGAAAATGCA
GATGCCAGCACCAACGTCAACTTCAGCAGAGGAGCTAGTACCAGGGCTGGCTTCAGCGAT
GGTGCTAGTATTAGCTTCAATGGTGCACCCAGCTCCAGTGGTGGCTTCAGTGGTGGACCT
GGCATTACCTTTGGTGTTGCACCCAGCACCAGTGCCAGCTTCAGCAATACAGCCAGCATT
AGCTTTGGTGGTACACTGAGCACTAGCTCCAGCTTCAGCAGCGCAGCCAGCATTAGCTTT
GGTTGTGCACACAGCACCAGCACTAGTTTCAGCAGTGAAGCCAGCATTAGCTTTGGTGGC
ATGCCTTGTACCAGTGCCAGCTTTAGTGGTGGAGTCAGCTCTAGTTTTAGTGGCCCACTC
AGCACCAGTGCCACTTTCAGTGGTGGAGCCAGCTCTGGCTTTGGAGGCACACTCAGCACC
ACGGCTGGCTTTAGTGGTGTACTCAGCACTAGCACCAGCTTTGGCAGTGCACCCACAACG
AGCACAGTCTTCAGTAGTGCGCTTAGCACCAGCACTGGCTTTGGAGGCATACTCAGCACC
AGTGTCTGTTTTGGTGGCTCTCCCAGCTCCAGTGGTAGCTTTGGTGGTACACTCAGTACC
AGTATCTGCTTCGGTGGCTCTCCCTGCACCAGCACTGGCTTTGGAGGCACACTTAGCACC
AGTGTCTCCTTTGGTGGCTCTTCCAGCACCAGTGCCAATTTTGGTGGTACACTAAGTACC
AGCATCTGCTTTGATGGCTCTCCCAGCACTGGTGCTGGCTTTGGTGGTGCTCTCAACACC
AGTGCCAGCTTTGGCAGTGTGCTCAACACCAGTACTGGTTTTGGTGGTGCTATGAGCACC
AGTGCTGACTTTGGCGGTACACTAAGCACCAGTGTCTGCTTTGGTGGCTCTCCTGGCACC
AGTGTCAGCTTTGGCAGTGCACTCAACACCAATGCTGGTTATGGTGGTGCTGTCAGCACC
AACACTGACTTTGGTGGTACACTAAGCACCAGCGTCTGTTTTGGTGGCTCTCCCAGCACC
AGTGCTGGCTTTGGTGGTGCACTCAACACCAATGCCAGCTTTGGCTGTGCCGTCAGCACC
AGTGCCAGCTTCAGTGGTGCTGTCAGCACCAGTGCTTGCTTCAGTGGTGCACCAATCACC
AACCCTGGCTTTGGCGGTGCATTTAGCACCAGTGCTGGCTTCGGTGGGGCACTTAGTACC
GCTGCTGACTTCGGTGGTACTCCCAGCAACAGCATTGGCTTTGGTGCTGCTCCCAGCACC
AGTGTCAGCTTTGGTGGTGCTCATGGCACCAGCCTCTGTTTTGGTGGAGCTCCCAGCACC
AGCCTCTGCTTTGGCAGTGCATCTAATACTAACCTATGCTTTGGTGGCCCTCCTAGCACC
AGTGCCTGCTTTAGTGGTGCTACCAGCCCTAGTTTTTGTGATGGACCCAGCACCAGTACC
GGTTTCAGCTTTGGCAATGGGTTAAGCACCAATGCTGGATTTGGTGGTGGACTGAACACC
AGTGCTGGCTTTGGTGGTGGCCTAGGCACCAGTGCTGGCTTCAGTGGTGGCCTAAGCACA
AGTTCTGGCTTTGATGGTGGGCTAGGTACCAGCGCTGGCTTCGGTGGAGGACCAGGCACC
AGCACTGGTTTTGGTGGTGGACTGGGCACCAGTGCTGGCTTCAGTGGCGGACTGGGCACC
AGTGCTGGCTTTGGTGGTGGACTGGTCACTAGTGATGGCTTTGGTGGTGGACTGGGCACC
AATGCTAGTTTCGGCAGCACACTTGGCACCAGTGCTGGCTTTAGTGGTGGCCTCAGCACC
AGCGATGGCTTTGGCAGTAGGCCTAATGCCAGCTTCGACAGAGGACTGAGTACCATCATT
GGCTTTGGCAGTGGTTCCAACACCAGCACTGGCTTTACTGGCGAACCCAGCACCAGCACG
GGCTTCAGTAGTGGACCCAGTTCTATTGTTGGCTTCAGCGGTGGACCAAGCACTGGTGTT
GGCTTCTGCAGTGGACCAAGCACCAGTGGCTTCAGCGGTGGACCGAGCACAGGAGCTGGC
TTCGGCGGTGGACCAAACACTGGTGCTGGCTTTGGTGGTGGACCGAGCACCAGTGCTGGC
TTTGGCAGTGGAGCCGCCAGTCTTGGTGCCTGTGGCTTCTCGTATGGCTAGTGAGGTTTC
AGGTAACTGCAATATTTCCATAGCCAGGACCCACAGGGATGGGTACAAGAGCTGGGAGAT
GTTGTAAGAAACACTAAGGCAGGACAGCAGGGTGGAAAGGTGAGGGCAATTAAGGAATTA
TGAGAAGACAGTGTATTTGGTGCTAAAATGTGTTCCTATTTGTTTTGTTTTCAGATTTAT
TCCCCATGTTTACAGATACCGCTAATAAATTGCAGTAGTCCTTCCCATGGAGCCAAAGTA
CATCCTTGGAATCTTTGTCCACACAGCAGTCAAGGCAGTTATGGCCAATCAGCTGAGGGT
GTCATGTGATGGAAAAATCTGTTTGCTGTTCCTGCTTTATTGTTTGCTTTCTGTGTGCTG
TCATATTTTGGTATCAGAGTTACATTAAATTTGCAAAATGAATTGGAGTTTTTTCTGTCT
TTTAATGTGCTTAGGTAGTTGTGGAGTGGCATCTTGGGTTCGTAGAAGAGCTGGAGATCA
GCATAGCTCTTTGGAGAATGTGGGTCTCCAGCTTTTGGCTCAAAGGCAAATATGATTTCA
GCAGGATAGAGGCCTGGGGAAAGCATGGCAGGCAAGAGGATAACAGGTTGAGGAAAGATA
TGGAGAGGGAAAGCCTGGAGCAGAAGGCAAACGGAGAGGCTTCTGGACAGTAAGTACAGA
TTGATTTTGAATCACTGGTGTAAGAATGGAGGGAAGGGCAGAGGTCACTAGGGGTGGACA
TAAGAACAAGGGAGGGTTTAATTGGGATAGGAGAGGAAAACTTGGGCATATTGTATAGAC
TGTGGGGCAAAAGCTAACAGGAACAGGAGATAGATATGGAAGAGTCAGGAATTGACTGAA
GTAGCCCATCCCTGAGAAGGTGGGATGGAATAGGGTACCAGAGAAGACAACCCTGACTTT
GAACAGACTTAAGGGTGGCTGTGGATGCAGATAAATATAGATCTGCTTCAAGCAGGGATC
AGCAACTTCTGTAGTAGACAACAACAACAACAAAAGGAGAGGTGGATTATACAAGGTTTA
GGTCTTGCTGGGTGGTTGTGATGGAAGGACAAGGGAACAAAGGCAGCAAGTGTATGAGTC
TGTCTCTTTACCACTGGGTCACTGGTACCTGGCTTATGGTAGCTGCCTGGAGAGTGGCTG
AAGAGATGGCCCATAGTATCCAACATAGTTAGGGACAGAACACTAAGGATAGATTGGGGG
ACAATAGAGCATTCAAAGGACTCTGCTCTTGATGCTGTACAGCAACAAATATTGTTCATT
CAAAAAATACTACAGGGCTGGGCACAGTGGCTCATGTCTGTAATCCCAGGACTTTGGGAG
AGGCCAAGATGGGAGGATTGCTTGAGCCCAGGAGTTCAAGACCAGCCTGGATAACATAGT
AAGACTTCGTCTCTACAGAATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1068, 2393..2481, 2768..3958, 4641..4745, 4860..4923, 5179..5258, 5782..5873, 6600..6679, 6773..6815, 7233..7295, 7857..7971, 8793..8900, 11394..11621
2437..2481, 2768..3958, 4641..4745, 4860..4923, 5179..5258, 5782..5873, 6600..6679, 6773..6815, 7233..7295, 7857..7971, 8793..8900, 11394..11525
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved