Homo_sapiens Locus MAGED4B
snOPY snoRNA Orthological Gene Database
Homo_sapiens MAGED4B
Homo_sapiens
MAGED4B
X
SNORA11D
6799..6926
9446
GGCAGCGTGATTGTATCGCTGATAAGGAAGAGGCCTGACAATCTGAGTAGAGAGTGGAC
CCGGTGGAGCAATTCTCATACCTGGATGGACCCACATAGAGCCGCAGAGGCTGGGGGCGA
GGCGGGGGGAGGCTCTGTCTCCCTGTGTCCTGAATGCGGAGCATGAACTTAGGCCTTCTA
CAGCACAAACCTTGCTTCTTTGGGACAGATGTTGGGGTGGGGGAGGCCTGTCACTCAGAC
GGAGGAGGCGGTGCCTCTGTCCCCAGGCCAGCAGGAGCAGGAGGTGGACTTTGGAGTCCG
GAAGACCCAGGTTCAAATTTTGCATTTTCTGTTTCCTGGCTCTGTGGTCTAGTTCATGCA
ATGTGTCTGTGCCTCAGCTTCCTGACACGCCAAATGGGGATGCTGACATCCACTTCCCAG
CGCTGCTGTGAGAGGAAGAAAAGCCCCAGCACAGATCCCTCTGTGACATACAAGCTGCAT
AAAGGGTAGCTGAGGAAGCAGATGTTCCCAGTATGTCTGGGGGCCAGAGAGTTGGCTAGT
GGAGAAGCACACAAAGCGAAGTGCCATCCTCTGGCCATGTCCATTTCGTAGCCCCGCAGG
TTGAGGATTTCCACTTGTTGCAGTTAGAGACCCAGCTTATTAATTGTGAGACCTCACTAA
TTGTGACCTAAGGGGTCTTGCCGGGGAAACGGGGCATAGTGTATCCCAGACCAGGCTGGA
GGAGTTTGGGTGAAAGGGCAGGGCAGGACAGAGAAGCATTGTGCAAAAGTGGGGGGACTG
AGAAGAGATGATTGGGTGGGTCGAGCTGCACTGCAGGGTATGAGTGTGCGCGCCCGCGGT
AGGAGGAGGAGGAGGAGGAGAGGTGAAGTGGATCTGGCGGGAAGAGCCCCCCGCACCCTA
CCTTCGACCCCACCGCCCACCCACCCGCGGAATCGCATGCGCACTGGAGACCTGGAGGAA
AGGGCTTTTGTTGGGAAAGCGGGCGGGCTGGAGGGGTCCGCGCATGCGCAGGCTACCCAG
CCGCGGGGGGTGCACGGAGAAAAGGGGCGGGGTGGTCCGGGCTGCTGTGCTGGCAGCAGT
AGGCGAGGGCGCGGCTGCGGGGTTCCTGGTGCTGAGGACGGACGCCATTGGAGTTCCCGA
GAAGGTAAGGATCCAGCCCCAGACAGGACCGGGAGAGGGCGAGTGGAACCCGACACGCTG
CGCCCTCCCTCCGCCTCCGGATCTGAACAAAGCCCAAGCACTCAGAACCGGAACCCCATT
AGACCCAAGGTCTAGATAGGAGCCCCCATCACCATCAGACCCAGGCGCCCCGATCTGAGC
CCTACTGAAACCGGAGCCCAGGATCCTCACCCCTTTAGCAGACCCGTGTGCTCCGAGCTG
AGCTCCCTTGGACCTGAGGCCCCACCCCCACCCCAACCACTCCTAGATTACTCGAACCGA
GCTGACCGCTTGCCCCCTTCCTGGAGTGCCCAGTCCTCGCGTTTGAGATCTGCAGCGCTC
CGATTGGAGCCTCACCTAGGTCTGAGGCCCCCACTCCATCCGCCTCTAGTGCTCGAGTCT
GAGCCCCACCTAGGCCCCCCGCCCGGACCTAGCCAAAGGTCCCTGGGGTTCTGTTTCGCA
GAGCTTGCGGCTTGCCACTGTCCCTGTTGTCTGAGCTCTCCCATCTGCTCCCCCTTCATC
CCGGTCCCCTTCTCTGGCCCGTAAATCCAAACCCTTTGTTTCTCTCTTCCCCAATGCATT
CCCTTTGGGACTCTTCGGACCCCAGCCCTCCAGAACACCCCCTCGTCAAATCTAGCCGCT
GGGATGGCGAGCCTGCCCATCCTAAACTCCGCTTTCAGTGCGGCGCCTCCTGCGACCTCC
TCTGTCCCTTTCCTTGGGCTCTGTCCCTGACCAGGTCTACCCCATCAGAAAGCCAAACCG
TCTCCCCCCCGCTCCTCCTCCCCCCCCCCGCCCCCTACTGCCTAATATTGCCTAGTAACC
TGATGATTGTCGCCCCTCACCTCCCGGGAGATCCCGCCTCCCATTGGATCCCGCCCCCTC
CCCCTGCAGCTGCTTCACCCTCCCTCTCAGGCTGAGCTCTCATCTCCCTGGGACCCGCAG
CATGGCTGAGGGAAGCTTCAGCGTGCAATCGGAAAGCTACAGTGTTGAAGACATGGATGA
GGGTAGCGACGAAGTCGGGGAGGAAGAGATGGTTGAAGGCAACGACTATGAAGAATTCGG
TGCGTTTGGTGGCTATGGCACCCTCACCAGCTTTGACATCCATATCCTCAGAGCCTTCGG
AAGCTTGGGTCCAGGCCTTCGCATCTTATCGGTGAGGCCCCTTCCTGGACACCTGCTGGC
CTGGGCCTTTCCCCTGTGAATGGGGGAGGGAGGAGGGGGGAGCCAGGAGGGTTGTGTGGG
AAAGGACTGCCCAGCTTCCCAAGCCTTCCCTCCCCTGCTCGGAAGAAGAAGATTTGGGAA
GGTCTTGGGGTGTTCAGGGCTGACTGCTGGGAAGAGGCTGGCCAGCACAGGGAAGCTAAC
ACAAGTATGTCGTCGAGTGGCCTGCCTTCCCCAACCCCTCTCTCTGGCCTTGCAGAATGA
GCCCTGGGAACTGGAAAACCCTGTGCTGGCCCAGACCCTGGTGGAGGCATTGCAGCTGGA
TCCGGAAACACTTGCCAATGAGACGGCCGCCCGTGCTGCCAACGTAGCCCGCGCCGCCGC
CTCCAACCGTGCGGCTCGGGCCGCTGCCGCCGCTGCCCGTACCGCCTTCAGTCAGGTGGT
CGCTAGCCACCGGGTGGCCACGCCGCAGGTCTCAGGAGAGGATACCCAGCCCACGACCTA
CGCCGCCGAGGCTCAGGGGCCCACCCCTGAGCCACCCCTTGCTTCTCCGCAGACCTCCCA
GATGTTAGTCACCAGTAAGATGGCTGCCCCCGAGGCTCCGGCAACCTCCGCACAGTCCCA
GACAGGCTCCCCGGCCCAGGAGGCTGCTACTGAGGGCCCTAGTAGCGCCTGTGCTTTCTC
TCAGGCTCCGTGTGCCAGGGAGGTGGACGCCAACCGGCCCAGCACAGCCTTCCTGGGCCA
GAATGATGTCTTCGATTTCACTCAGCCGGCAGGTGTCAGTGGCATGGCCTTCCCGCGCCC
CAAGAGACCTGCCCCAGCCCAAGAGGCTGCCACAGAGGGCCCCAGTGCTGCCTCTGGTGT
GCCCCAGACGGGACCTGGCAGGGAGGTGGCAGCCACCCGGCCCAAGACCACCAAGTCGGG
GAAGGCGCTGGCCAAGACTCGGTGGGTGGAGCCTCAGAATGTTGTGGCAGCAGCTGCTGC
CAAGGCCAAGATGGCCACGAGCATCCCTGAGCCGGAGGGTGCAGCTGCTGCCACTGCTCA
GCACAGTGCTGAGCCCTGGGCCAGGATGGGAGGCAAGAGGACCAAGAAGGTGAGATCCCC
CTGCCCCCTGCCACCTCCACACCCCCTTGCTCCTGTCCTTTCCTTCTCCTCCCTTTCCTG
CTCCTCTCCTCCCTCTCCTCTCCCCCTTCTTCCTCTCTTCTCCTCTTTCCCCTCCTTCTC
TCCTCACCTCCCCTCTCCTCCCCTCCTCTCCTCTCAGCTAGTCCATGTTTCTCCAACACA
AGTTTGCTGAGCATGTTTTCACTCCACGTAGTCCCTACCCTCAGGACTGGTGGGAGAAGA
GGCTGGCTCAGTGCCTGGCACTTAGTAAGCACGCAGCACATGCCAGCCGCTGCTGGTACT
GCTCTCATTTCCAAGAGCCTGCTACGGGTGAGGTGCGTGCCGGGTGCTTTGGCACGGGGA
GCCTGGTAGCCCTGGGTCTCTCCTCTCTCAAATGATACAGTCCAAGCACCTGGATGATGA
GTATGAGAGCAGCGAGGAGGAGAGAGAGACTCCCGCGGTCCCACCCACCTGGAGAGCATC
ACAGCCCTCATTGACGGTGCGGGCTCAGTTGGCCCCTCGGCCCCCGATGGCCCCGAGGTC
CCAGATACCCTCAAGGCACGTACTGTGCCTGCCCCCCCGCAACGTGACCCTTCTGCAGGA
GAGGGTAAGAAGCCCACCCTCCCCCATCTCCTTCCTCTCCTCCCTTGTGGGCCACGTCTC
TGCTGTCACCCATGCCTTGACCTCCCCGCATGTTCCTCCTTCTCCAGGCAAATAAGTTGG
TGAAATACCTGATGATTAAGGACTACAAGAAGATCCCCATCAAGCGCGCAGGTAGGCAGC
CTGTGCCCCCTTCACCATCCCCTAGTCTGTGGGCATCCCTTTGCTTGCGTGCCACGGCTG
GTCCCTCCATAGCCACAGGACGGGGTCCTGGCTGCGTCACCCTCGGCAGAGCTGACCAAG
GGGCTACAGCTCTATGACCCCTGCTCAGCCCAGGTGCTTTCTCCAACTCTTCCCCCTCCT
GCAGACATGCTGAAGGATGTCATCAGAGAATATGATGAACATTTCCCTGAGATCATTGAA
CGAGCAACGTACACCCTGGAAAAGGTGGGTGCAGGATGGGAGCAGCTCTGTGGGGGAAGA
GCGGGCATGGGGGTGCGGTGACCCTGCAGCCCCTCAAGGCCCAGTCTCTGGAGCCATCTC
TCACCTCTCCGACTCTGAGCTTCCACTGCACTGGCAGTTTGACTCGTGCTTCCTGCCCTC
GGCTTCTCTCTCTCATGCTCTCTGAGTGTCTCGCCGTCTGGCCAGGTGGGTCTCATCGCC
TCTGCCAGCGTCAGCTCCCACAGCGAAGGTCTTCCGTGTGCTGTCTTCTTCTGCCCTCGC
TCACGAGTTTGGATTCCTTGCTGAGGAGCAGTTCTAACCCGGAATCACTGTCTGCCGGCA
GGATGCCCAGCATGGGGTTTGGATCTCACACTCTGTTTTCTCCCCCACGTAGAAGTTTGG
GATCCACCTGAAGGAGATCGACAAGGAAGAACACCTGTATATTCTTGTCTGCACACGGGA
CTCCTCAGCTCGCCTCCTTGGAAAGTAAGAAAGGGAAAGCGGGTCGTGGCCTTCCTCGGT
GGTGTCCCTTCCCTGCCCACACCCCTTCAGTGAAGCAGGAAGACGGGGCTTGAGTGCGGC
GCACCGCTCCCACACACAGCGAGGGCTGCCTGGTGACTGCTGGATGAAAGGAATGATAGC
CTGGGGTGAGGCCTTGCTGCCATCAGTTCTCCCCAAGCTGCTGCCGGGCTTTATCCCCAA
AGCTTCGGAGGAAAGTGCCTCTTCCTCCTGCCTGCCTGGCCTGGGCCTGGCAGAGCTGGC
CTAGGGGAGAGCTGCCTCTTCAGTGTAGGTGCTGATGTGGAAGGGGCAGGAAAGGTCTGG
AGCCATCTCTGGGCACACGTTTGCCATTTGCAGAGCTTCGGCTCCCTGCCTCGCCCTGTC
CTCTGCAGAACCCTGTCAGGGAAGTGTTAGTACCCATGTTTTATAGAGGAGGCGATTAAG
TCTCAGGCGGAGGTGCGAATGGTCTGTCAGCAGCTAGTGAACTGTGCCTGTCCTGGGAAG
AGTTCCCCTCAAGCTGGGAAACCTGAGAGAGGCTAGTTGGGAGAGCCTGGTGGTGTCTCT
CAGGCAAATAGCTGCTAAACAGGATTTCTCTTTCCACACCTTTAGAACCAAGGACACTCC
CAGGCTGAGTCTCCTCTTGGTGATTCTGGGCGTCATCTTCATGAATGGCAACCGTGCCAG
CGAGGGTGAGTGGCTGGACCTGCAACTGGGGGGCTGCCCATAGTCTCATCTTCTGGGTGC
CAAACTCTCGTACCTCCTCTCCCCTCGCAGCTGTCCTCTGGGAGGCACTACGCAAGATGG
GACTGCGCCCTGGGTATGATTGGCCTCTCCAGCTCCTCCCCTCGGTGCTATCCTCTGGCC
AAAGAGGTCCTGGGATTGCAATAGCCTGGTGGTCTGGCGCAAGGGCGTGGGGTGCCCTGG
GCTCGGTAGAGAGCAAAGGATCTCACCAGGGCGGATGGGGAAGCGGTGCTGGACGCTGCT
CAGCCCTCTCTCTGCTCTGTGGCCCCAGATGACATCTAAGAGAGACAGTCAGAGTCAGGG
ATTCCATCAAATCCCTACCTGGGGCGTCCCTGACCAACAGTCCTCTGGCCTCTGCTGCAT
GCCCAGGCCTCCACAGCGACTCCCCGGGGGCTGGGAAGTCATAGTCATGCTAGGGAGGGC
CCCTGCCACCGTCTCTGCTCATGGATTCCTTTCCTTGCCCTCAGGGTGAGGCACCCATTC
CTCGGCGATCTGAGGAAGCTCATCACAGATGACTTTGTGAAGCAGAAGTAAGTATCACCT
GAGCTAACTGCGGCTCTCACTCGAGCATCCTTTGTGTGCTGGTCTGGCTGAGAAAGCAGT
TCCCTATCCCAAATCTTCAACTGGAGGGATGGGTGCCTCTGACCTGGGAGTGAGTGGCAG
TGGGGGGTATGCGAGTGTGTGGGGAGCCGAAGGCCAGGGCGGTCTTGGGAAAAGGGAGCT
CACGTCACCTGAGAACACGGTGTGGGGTGTGAAAACGGCCGCCATCACCTTGAGCACCTG
CCCTGTAGACTGACACAAGAGTTCCCCCTGGTTTACACCTAAGGAACCCGGAGCTCAGAG
AGGAGACGCCTCTGAGCATGGCTCCCAGCTGGTAAGGGCCTCAGCCCAACTCTCCTGATT
TTCAGGCCAGGGGCCACCCTCTCCCCGTCCCTGGAGGACTTGCCAACGCACAGGCGCGCA
TGCACACCAACAAAGGGTCAGGACTTGAGGAGGATGCCTGGAGCACGCTTCTCCTGGCTG
ACTGTTTCTTCCTCTCCAGTCGTTTCCTCTGGTGGGCCTCTCCAGGGCTCCGCCGGGGTG
TGGCCAAGACCCTCGAGGTGGGGTGTGCTCAGAGCAGGGGGCCTGAAGAATGGCTCCTCT
GTTTACAACACACCCAACAGGAAGCTGGGGTCATCGTGATGAGGGGCACAAACTTGTGGC
CTCCCTACAGACAAATGCCCTACATGTGGACCCCCTGCACCTCCGCATGGCTTCCGGGGA
GGACCAATGGCAAAAGGCTTTGAAGGCCTCACTTTTGCAGGCAGAAGTCCTGGGAGTGGG
TTTGGGAATGAGTGAAGGGCTGGAGGGGCAGGACAGTCCTCTTCCAGGAGCTGAGCTGCG
GCATCGGGTTGAGGAGGGGCCCCCTGGAACCCATCCGTTCAGCAACAGGTCTGCTTGGCT
AGCAGCAAAGTTTACTTTCCTCTCATGCCAAGGTACCTGGAATACAAGAAGATCCCCAAC
AGCAACCCACCTGAGTATGAATTCCTCTGGGGCCTGCGAGCCCGCCATGAGACCAGCAAG
ATGAGGGTCCTGAGATTCATCGCCCAGGTAAGGGAGCGCCTCTGTTGGGTGCCCGGCACC
GGGGGTGGTGCTCTCCACACCTTGCTTGTTTCTTGGTCGAGGCCTCCTTCCCATTACCCC
GTATTCCAGTGAGGGTACCAAACACTCACAGAGGCACCTGAGCACCCTACACAAGGTCAC
AGATGGGGCAAAATCCCAGGTCTGGCACAGGAGAGTAGGAGCCCCCAATCCCTGTGGTCC
TGATTTTTGCCATCATTGCACAAAGCACACGGGAGGGGGTGAGGCGGGCCGCGGGTGCTC
AGCCAGTGTGGGGTAGCTCTGTGTCTATGCCTGCCCTTTTCCTCCTCAGAATCAGAACCG
AGACCCCCGGGAATGGAAGGCTCATTTCTTGGAGGCTGTGGATGATGCTTTCAAGACAAT
GGATGTGGATATGGCCGAGGAACATGCCAGGGCCCAGATGAGGGCCCAGATGAATATCGG
GGATGAAGCGCTGATTGGACGGTGGAGCTGGGATGACATACAAGTCGAGCTCCTGACCTG
GGATGAGGACGGAGATTTTGGCGATGCCTGGGCCAGGATCCCCTTTGCTTTCTGGGCCAG
ATACCATCAGTACATTCTGAATAGCAACCGTGCCAACAGGAGGGCCACGTGGAGAGCTGG
CGTCAGCAGTGGCACCAATGGAGGGGCCAGCACCAGCGTCCTAGATGGCCCCAGCACCAG
CTCCACCATCCGGACCAGAAATGCTGCCAGAGCTGGCGCCAGCTTCTTCTCCTGGATCCA
GTAAGAGTTTCGGTAGAGAAATGAGACTCTGCAGGAGGGCTGCGGAGGGGGGTGAGATGT
CAGAGGGAGGGCCAGGGTGGGGGCGCTGGGGGCAACGGCAACAGCATGGACGGACACTTA
TTTTGTTACGTACACCCCTCCCTGGTTCGCGTGTGTCCACGGATGTTGTCACTTTGGTTT
CTTGTGCTTTTATAGGCACCGTTGACGAACTGCAGCGATCTTACTGGCCAAGCCAGAGCG
CCTCCTCTCAGATTCCTTCTCGACACAGCACCCTAGGCGGCTTCTTCCTGTCAGTCGGAG
GTGGCATGCAAGATGAAGCTCTCTTTGCTCTTCCTGCTTTCATTTTGTGCTTTTCCTTGT
GTTTTCATGTTTTGGGTATCAGTGTTACATTAAAGTTGCAAAATTAATTTGGATGTTTCT
TCCTTTACCTGCACACCCATTGCTATACCTGGCCACGCTTGGGCTTGTAGCAAGGAAACT
TCTTCAGGCTCTCTGGGGTAGGTGGGCCCCACCTCTGCCAAAAAGGCCCACAGGGACAGG
TGGGATGCTGGGAGGTGCGGAGGTTGGTTACGCCTGAGTGCGTGAGCAGGAGTTTGGAGA
GGCCCCAGTGCTCATCGTTATGTGATTTTCTACAAACCTTGCTCAGCAGCCCCAGGGACA
TGGCAAGAGTCGGGGCCACAGCAGGGGCGGGGTGGAAAATTGCAGCTTGGTGCCACTGCC
CCTCCCGCCGAGGGACAGGGTCCAAGGCTCTCACCAGGACCCACCTCCCACACCCCCTCC
TTGGAGATGATGTTCCGGAACCCTTGGCTCATCATCCACACAGTTCAGGACCCCGTCCTC
GGTACAGAGTCTGACGGACAATGAGGTGGGCCCCGCAGTGATGTTCGCAGCCCTCCAGTG
GGTAGAAGGAGGGGCCGTGATTGCTGAGGGAGCAGGATGTAATAAAAACAACGCACGGTG
CACGCGTACACAGCCCCTTGCCTGTGACGGAACGGCGGCCTGTTTGGAGCTTCGCAGCCC
TTCTCCCCCAGCAGCAGGGCTCTCCCAGTGAGGACAACACCAGGCCTACCTAGGTCCTGG
TGTGTTCAAGGGCTGGGTGATGTCTGGAGGGGTCTGAGGTAGGGCTGCACATGCTTCAGG
TACAAGACAGTGAGGGCAGAGACAGTTTGGTCTCCTGGGAAGGGCTCAGTGGCAGGCAGG
GACAGTGTCCAGGGCTTCTGGAGTTCCCCGGTAATGTCCAGGGCTTGGGAGGACAGAGCC
CTAGATAAGGAGGGAAAACATAGCAGTGGAAGGCTCCCTGCTTCCCACCCCCTCACCCAG
CCCCAGCCTCTGTTTCCCCAGGAGGGGCTGCCATCTCCGCCACGGCCAGATCCTGACCCA
GACCGGGCTACCTAATTTGGGAGGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1143, 2100..2310, 2575..3408, 3820..4023, 4127..4190, 4384..4463, 4852..4943, 5565..5644, 5730..5772, 6164..6226, 7172..7286, 7609..8051, 8235..8446
2101..2310, 2575..3408, 3820..4023, 4127..4190, 4384..4463, 4852..4943, 5565..5644, 5730..5772, 6164..6226, 7172..7286, 7609..8040
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved