Homo_sapiens Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Homo_sapiens EIF4A2
Homo_sapiens
EIF4A2
3
SNORD2, SNORA63, SNORA4
2225..2294, 4729..4860, 5041..5178
8323
AGCTTAAAGACCCGTGCAGTTTACGCAGCAAGGATATTATTGCTCTGAATTTCAATAAA
TCAACATTTCACTATATATCGGCAAAGTCTACAGCCTTTAAAAAATGACCAATATAGACG
GAATCAAAACCGATGTAGTCCCAAAGCGGCACAGAGCTGTATCTGCCAAAGCGTCCATTT
AAATTCGTGCGTTCCAAGGAAAATTACTGCTTAGTTTCTATCCATTTGCAAAAGTTTATG
ATTTTTTTCAGGCATTCCTCACACCTGTTAGGTTAAAATCAGTAACACTCTTAAAAAGAA
AGCGAGAGACCGGAAATGATATGAGAATAGAATTGGCCACTCCAGAGACATCTGCAAATG
ACACTCCATTTTTCCTTCTCGCGCTGCAAAATGTACCGGTAAACCGGACTTCCCGGGACT
CGCTGGGTGGCCGACATTTTCCCTAGCAGGAATTTTACGTTTCCAAGATCTGAATGGATG
TTAACGGTCGGGCTAAATGCCAGGCAGGTCTTCATTGTGGAATTAAACAGCGGTGGGAGC
AAGCGGAATAACCGAGTTCCCCTCCCGCACCTGAGTGCCGGCAGCGAGCCGCGAGCCGGG
ACCTGTCACCCGCGGGAAGCCCCGGCCGCCCGACGAACAGCATCTCCGGTTTCCGCCTCC
GGCTCCGGCGCGGCTCCCCCGGCCCGCCTCTGCGTCAGGGACGCGGAAACCCCGTAGGAG
CAGGGCGGGCGGGGAAAGCGAGGTTTAACTAACTCCGCAGCTATATTCTTCCGCCGCGAG
GTAAAGAGTCCCAACCCAACCCCGGGCCCTAGGATTTCCAGCGACCCTGTAATATCGAGA
AATTACCACATTTGGGTTTTTCTACCAACTTGCTTAGGATTTTATCCGAGGTAACGACCC
CAGGATCACAATTTTGTAGCTGACCGAAGCACGGCGAGAAAATTCCTCCGCAAGAAACGG
GTTCCGGCCACGAGCCTATAAAAAACGGGTGGTTGGGCGCCGCTGTCTTTTCAGTCGGGC
GCTGAGTGGTTTTTCGGATCATGTCTGGTGGCTCCGCGGATTATAACAGGTATGCAGTCT
GTTGGCGGTCGCGGTCTGTAGTGAAGGTCATAGGGCGCCAGGGGAGATGATAGTGGATGG
CACGGAGGCAAAAACTCTAAATTAATGGACGTTTTCTTAGGGTACAGCACTCCTGTGCCC
TTCCAGAAGCTTCCATGATGGGTAGGGCCCGGATTGTGGGGAGATAGGACGGTGGTGCGA
AAGCAGTGGCTAAAGGGCGTTTTTCCTCTCTAAGACATTACGAAACTTCGGCTGCTTTCC
TTCCCAGTGTAGAGCACGGGAAACATGGAGTAAAAAGCCGTGGCGCAGTCCGAGTTCGGT
ACACTGTAACCAGGACCCGAAGCTTTATTTTCGGTCATCCACACGAGTTGGGGGAGGGTC
CTAGGCTTTACTTGGGGAAGGGTTGGAGGCAGCGGTCTCCACTCGGCCACGGCGCGGAGG
CGACGGGACAGGACCGGTGCCGGTGAACCGTTGGCATCGCCCTCGCCAGGCCGCTCCGCC
CGCGTCAATCACCCGGCTTGCGCATTGTTGGGGGCGGAGTTCGGCGCTCCGAGCTCTCGC
GAGACGCTCCGCAGTTGAAACGGGATCGCCATGCGCTCGGGCCTGGGGGGCTGCCTTTCC
GGGCATCCGCAGGCCCCAACCTTTAGGGAAGGCGCACAGTGTGGATATTCGCCCTGAGGC
TGCTGCTTTAGCTTGTGCAGGGGAGGCTAACGTGCTGAGACGGGTTGCAAAGGGCTATGC
GCTTAAGGTGCAGTTGAGGTGGCCTGGAAGGGGTGTCTGACTGCAGTATTCTTGTCAGCA
GAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGGTAAGAAACGGTT
GTGGATCTTGAAGCTTTGGAAAGGTGAGTGTGTTCATCTCATTTATGCGTGCATTATTTT
TTCTAACTTACAGAGCAACTGGAATGAGATTGTTGATAACTTTGATGATATGAATTTAAA
GGAGTCTCTCCTTCGTGGCATCTATGCTTACGGTTTTGAGAAGCCTTCCGCTATTCAGCA
GAGAGCTATTATTCCCTGTATTAAAGGTAAAAGAAACTGGCATTTTTAGGAAATTGTTCT
ACATAGACATGAACCATAAAAGGGAAAGTAACCTCTGGGGGACTAGCACCTGTTTGTATT
CCTTAAAGTGAAATGATGGCAATCATCTTTCGGGACTGACCTGAAATGAAGAGAATACTC
ATTGCTGATCACTTGATTATTTGGGCATAATGTTCCAAATGGAATACATGGTGTGAAGTA
GAAGTGACAATTTGATGTGGGATCGGTAAATGTGTATCCTACTTTTTTTAGGGTATGATG
TGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGC
AACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAAC
TGGCTCAACAGGTATTGATAGTGTAGTTCAAAAAAACTGCTTGCGTGTTGCATAGGTTTC
AGGTTTCACAACTGTGAAGAATTTAAAACTTAGTATAAATTGGTCCTACCAGATCCCTCC
TTTTAATTGTCCATGCATGCAGGGAGTTTTTGTTGAAAGTTTTAAAAGAACTGGGTATGC
AGGTATGGTTTGTAGGGTTGTATACTAATAGATTGAGAATCCGAAGCGCTCTCTTGGATG
TACTAGATCTGTCCCCATTTTTTAAGTTTGAATGCAGTTGTGCAACATGAAAACTGCAGT
GACATGTTACCATTTGACTGTCTCCGTAGTTCGTGATGCATCTGTTGCATGCTATGTTTT
CAAAGCTCACTGCTATATTGGCTTTGAAGTAAACCTTCCTAATAAAGCTGTAGGCTTTAT
TGAGGTCAGGATTATATAAGGCACAATACCCTCTGGGGGAAAAAAATCATTTGCCCTAGC
TGTAATTACAGAACATAAATTTCACTACGTACTCCCTACCTACAGTGAAGAATAATGTAG
GAAACGTTATTCTTGGATTGTCTAGCTGATGCGTGGAGCAGCAGCATCCCAAGTTTGACA
AGGCATAAGAAAGACATTAAGGGAATTTTACCTTGCAGCAGTTAGGTCGTCTGCATTTTA
AGCTTGGAAGTAGTTTTGTGCTGTGCATGCATAAAAGCTGTTGGCAGACCAGATTATATT
TGCCTTTATGCTTTAAAAATTAGTCATTGATCCTGGAGTTCTGCGGAATAATAATTAAGG
CTTGGGTTTTAGATCCAAAAGGTAATTCTGGCACTTGGAGACTATATGGGAGCCACTTGT
CATGCCTGCATTGGTGGAACAAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCA
CCACATATTGTTGTTGGTACACCCGGGAGAGTGTTTGATATGTTAAACAGAAGATACCTT
TGTAAGTATTGTCTTTAAGAGAGTATTTTTTTTAAAACTGTTAACATAGTTGAAAAGTCA
AATTGTATCACTGAGTAGATCTAGAAATGACAGTATGACTTTGTTTCTAACAGCTCCAAA
ATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGTGGTTTTAAGGA
TCAAATCTATGAGATTTTCCAAAAACTAAACACAAGTATTCAGGTAAGCATTACTTCACC
CCCCTCTTAAAGGTAGAGATGGGGTTTATTTAATGCAGGTACTGTTACAATACAACTGAT
GTGTTTTGTTGTCGTTCCCCCTGCTTAAAGCACTTGATGCATAACTCTGTCTACCTTCAT
TCCGTAGTAAGACAGAGACGCTTGGCTTCAGACATTTTCCTTTGGGTATTAATGTGTAAG
TTGTGCTACAACATAATTTTCTCTTTTTAAGGTTGTGTTGCTTTCTGCCACAATGCCAAC
TGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAAAA
GGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAGAGAGAGGTAAC
TGTCTGATTGTTAGACATTATTTTACCTTCTTGTATAAGCACTGTGCTAAAATTGCAGAC
ACTAGGACCATGTCTTGGTTTTTGCAATAATGCTAGCAGAGTACACACAAGAAGAAAAGT
AACAGCACTAGATTGTAAAGACTGGGGTGGACCTCTTTCTTAATGTCCAATGTCCTTTGT
CTTAAGATTTGGTGCAATATCTCATTAGACCTAACAGAATGAAGTTAATTTTTATAATTT
CTACGTTTTGAGACTGGGTTATGAGACTGGCTAAGACTGGCCAATTTTGGTATTTTGGGT
AGAGACAGTTTCACTTTCTTGAAACCCTGGTCTGGTTGGAACTCTGGGCTCTAAGTGCTA
GGATCCCAAAGGGCTGGGATTACAGGCATTAGCACTGTGGCTGGCCCAGAATGAATTTTT
AACTGAAGAGTTGGAAAAACTAAATGACTGTTAACTTTAACTTCTAAACATTACAGGAAT
GGAAGTTGGATACACTTTGTGACTTGTACGAGACACTGACCATTACACAGGCTGTTATTT
TTCTCAATACGAGGCGCAAGGTGGACTGGCTGACTGAGAAGATGCATGCCAGAGACTTCA
CAGTTTCTGCTCTGGTAAGAGGTGTTCTAAAATGTCTGGATTTCCACTAAAGCAGGATTC
AGACTACAATATAGCTGCTAAGTGCTGTGTTGTCGTTCCCCCTGCTTAAAATAAAGTTGT
TTCTTAACTATACCTGTCTGCTATTCTCCTGTAGCAGCCAGGGACGCTTGGTCTCATACA
TGTTGATTAAAATTAAATACCGACCTGACTGGTGATTCTTGAATTAAGGTTTATTAATTT
GCAGCATGGTGACATGGACCAGAAGGAGAGAGATGTTATCATGAGGGAATTCCGGTCAGG
GTCAAGTCGTGTTCTGATCACTACTGACTTGTTGGTAAGTCTCTTAATGCTTTTTAAAAA
TCTACCAAAAGTTAGCTTTTTGGGGGGCAGGTTTTTAAGTAACCTTTGCCAACTTGGGCT
ATTTGGAAGAGTAAAAGACCACACTCCACAGTGGGCTATACCACTTAGTATAGTTCGCTA
CTATTTTGTGGCCTACATGACAGGTGTCAAGTTTTTTTGAATCAATTTTTAAAACATGCC
ATTGTGTTTCAGGCTCGCGGGATTGATGTGCAACAAGTGTCTTTGGTTATAAATTATGAT
CTACCTACCAATCGTGAAAACTATATTCACAGGTGAGAAGCCAGCATCTTGGCTGTATTG
AAAAAAATTCATACGTTTTTCTACTGTGATTTGTATGAAAGGTAACATCAAATCAAGGAA
TAGATTCAGTAAAGTCAGTAGTGTTCAGTAAGATGATGTAATTAAATTTGTACTAGGGAA
GGTTGATGAGAACAAAGTGGGAAAACTTGTAAACATTGCCCAGATTGTGGACATAGGGTT
TTTTTCCACAATTGTTGGTCTTACCTTATGCTTGAGCTTTTAGTGATGTTCTTGTGTCCA
TGTGTTTTTCTTGGTGATTTTTTCTATAGTTGGGATTTTCTTGGTGTCGCCTGGTAGCAA
TTTGAGTGAACCCTGGTTTAGTTATAGTGGCTTTATCCCTAAATAAATTGAATTGTACTT
TGTTATATGATGTAAAAAAAGACTTTTTAAAAAATACAGGAGTCGATAGCAGCAGTTGGT
GACGAGATGGCACTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAA
CAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGTTTTTCTTTTGTCATGA
TTATTTGATTTTTAAGTTGCTCCAGCTAAGGCATTTTTTTGTATTAGTATTTCTATTAGG
GAACCTTTCTTATTAGGTGGTTTGTATTGTCTGGTTTCTAACATGCAGGTAGCTGTTTGG
CAGTTAAACACGTTTAGAGTAATTTGAGTTACAACGTGTGAAACTGAGCAAAAAAGCAGT
GATAAGTTTGGGTTACCATACCAAATATTTGTTTTCCCACTGGAAAAAAGTAAGTTTTAG
AAAATAGTTAACCTTTGCAGCATTTGTTTACAGTTTACAGTTCCAGAAGTGCGTCGAAAT
GGATTACATAACTGCTCTTTTATTCCTGGTGTTCACATCTGTCCCAGGCTGACACCTGCT
CTTGGCTGGCCCACTTTGGTATGGGCTTTAATTTCACTACCCCAAACACGATACTGTCAT
CTGCTTTATAATAATGCTCAAGATGCCTGATAAAAATCTCATTTTGCAGCCAGACAAGCC
TTGAATCCTTTTGGCACTAACTGCAAAGGAAGATTTTTTTCTCTAGATATGCATTAGCAG
CTAGTGCTCCAGTTAGAAGCACGAACTATAACCTTGATAAGTAAACAGCAGCTGGTGGTT
AACAAGTGGATCGTCATGTTCAGTAGTTTATACATTATGTGAGAAGTAACGTTCTGATTC
TTTTTCTTACACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAAC
TTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACA
GTGGAGGAGATGCCCATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGAGTTTTGG
ATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGG
GAATATTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGATTTTGATAGCAA
AGCGACGTTAGTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTA
GACTGTTGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTCTTTCTTAGAAATTTAT
TTCCTAGTTCTGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGT
GGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCATATCTGC
CTTTATTGTGTTTGTCATTAGCCTGAGTAGAAAGGCCTTTAAAATTTTTTTAGAAAGCAT
TTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTG
TGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCCTAGGTAGGGTTTAATCCCCAGT
AAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCA
CTTTAAAGGTGCTTTTGGTCATTTTATTTTTATTACAACTTCATTATTTACAAAACCCCC
CATCCAGATATATTCACGTTAACAATTCTGAGATAACTGCTGCATCACAGTTGCACAAAG
GCTGATGAGTTGCAAATGTTCATCAGCACCATCTGCTAGGCATTTGTCAACTTCCTACGA
GAAAAATTTAAGAAATTAGCATCCTTCAGGTAGTTAAATGTTCCATTGACATGTGCAAAG
TACCTACTTACGGCAAGTTTTTCTGTGATAATAGACTTCTGTTTATCAGATAAGTTATTT
TCTACAACCACATCATGGAGTTGATTGACGAGCTGAGTTGCTGCATGACCCTCATCTATT
AAATCCTATAATAAAAAAAACTTTTGGTATGATGACTTAATATTCCTTTCCCCAAAGTTA
GTAAGCTGACTTTACCTTGACCACAGCTTCTAGTTTGTCAAAAGAGCCACTCTGACAGGC
AGCAAATACTCCATCAATTTTCTCAGCTGGTATTACCTAGGTAATTGAATGTTCGGTATT
AAAGATGTTTCTAGGTGAGACTAGACATACACTCTGCCAACTGGCCCCCGTGCCCCCAGT
CATTTCTGTTCCACACCTAAGTTCCATACTTTCCTGGGAAGGCTTTGGGAGAACGGAAAG
GGCCAGAGTAACTCCAGTCACCACTAAGCAACCAAGGTGCTAACAACTGTGCTTTTAAAG
CCCTTTAATGGCTTTGTGAACTTCCAAGTTTGGGCACACATGGATTATAGCTTGTTCTGG
TCAGTGGATGAAGATTAAGTTTTCCCCTAGCGGCTATAACGATTCCTCAGAACAGTGGCC
AAGATCAATCAAAAAGACTGATTTCTTTAAAGGGGAAGTGCCCTTTCTCTCAATGTCTCC
ATGTAAAGATGCCACTAATGAGATTGGTTTAAAAAGTCCACAATATCCAGAAAATTAAAG
AGGATTAGTGGTACCAGTCTTGTCATATGGAAGGCCTACCGTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1068, 1861..1906, 1993..2125, 2391..2530, 3312..3480, 3593..3702, 3931..4074, 4556..4693, 4924..5013, 5232..5311, 6554..7323
1040..1068, 1861..1906, 1993..2125, 2391..2530, 3312..3480, 3593..3702, 3931..4074, 4556..4693, 4924..5013, 5232..5311, 6554..6695
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved