Homo_sapiens Locus RPSA
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPSA
Homo_sapiens
RPSA
3
SNORA6, SNORA62
2672..2820, 5335..5488
7823
tatttttttgtttgttttttggagacagaatttcgctctattgcccaggctggagtgca
gcggtgcaatcacattcactgcagacttgacctctaggctcaagctatcctcctgcctca
gcctcctgagtagctgagactacagggacgcaccatcatgattggttaatttttgtattt
tttgtggagatgggggtctccccatgtttcccaggctagtcttgaacttctgagctcagg
caatccacccacctcggcctcccaaagtgctgggattacaggcacaagccaccgcgcccg
gcaaacttatctcctactgatggatattgcaaaatttttcttctaccaaaaaaaaaaaaa
aaaaaaagatagatataatccataccatctgttcaatcttgtcctttttaactttttcag
ggaaacttcccccaggtgatagatggatagatacatgagatagacataacgcatacgatc
agttcaatcttatcttttttaactttttcagagaaaacttcccttaagtgaacatttaaa
tctgaattacgtcctgttaaactgttctccaggaaaataaaataaaataaatcttcaagt
ttttgtttacctaacaatttgttgtgtcgaacaaaccttcctacttttcaggtaacaaaa
tggcagcttaggctagaaagccgctcatattcgcaggtacaagggctgggtaagaacgcc
ccgcctggctgactaacttgagttccgcgctctggacaggaattatgcacagggcgtcgc
tgtggcactagaaaccccaaagtcacaagcgccccagatccgaccaggatgccgctaccg
gctacagcccagaggcccgctcctgcggcgcaagcccgccttcctgaagaaaaagcccag
tcccggcagcgttcttctccggctccgcccttcttccgctcgactttctttgccattggc
tgacaacggagtacataaggacgtcatttcctgccgcctgtCTTTTCCGTGCTACCTGCA
GAGGGGTCCATACGGCGTTGTTCTGGgtgagttccgtgtagcgtccctggcgccttccag
ggctagaaaaatgagcttttcctgctcaaatgaagggtgagaagactagtgatgaaagcc
ggtcagactggatctgtctcccgcccggcgcgccccaccttaggcctgcggcccgcacgt
ggccaggctcgggctggcgggttcccagagtgccccgggagcgggtggaggccgccctcc
agcggaggctccgagctggggttcggaccaggccgcgggtgggcgggagtgcagaaagcg
ggctaacatcctgtgttgctatcccttcggagtcccacacggcggtgagtctaggcccag
gcgctgatttacaccagctacttgggctggtcgggttttcccttcgcgccgtgcgggtca
ggagttaaggttctcgggtttttagacaaacaagtggtgacagcacagcgaagtaattcc
aaagcatccgcctacaatctgcttgaaaatgtctgaaaacaattcatgccttttttgcct
ttagtttgcatattccaaacatggctgctcttttgtatctagttgttaacttggcgcatc
cacaacttttccttaattcctatcttgagaagtgttgaatttccattcgctaatttcgtg
tagttttattactcggttactctgccgtccacactatttcctcagtaagatgtgcgctgt
tccgtaatacacgacatgtatgggttaactttctgtttacccttcactacactgtaagct
caatgcctgacactatagcagatggagtttttggttgcttttaagggtgtgccctactta
actcaatggaatgaaaagaaataggttgctctcttatttcagATTCCCGTCGTAACTTAA
AGGGAAATTTTCACAATGTCCGGAGCCCTTGATGTCCTGCAAATGAAGGAGGAGGATGTC
CTTAAGTTCCTTGCAGCAGGAACCCACTTAGGTGGCACCAATCTTGACTTCCAGATGGAA
CAGTACATCTATAAAAGGAAAAGTGATGgttagtcattgctttaattttttgttactcca
gctgtaagtacaaattttgagcttgctattctcgtggttagttctgggtaatttctttct
atcttccttaaatgaagccagacccctacgttgaaaacatactttaaataaatgttcttg
ttattgagagaaaagatttctgctccaggggaggaatatgtcagttgtctgagttacggg
acttgggttgggtcatgaacatgagaaagttcattggctgagtttctaatagctcgcata
gtgccttcaacttcataggtacttacacaggctattgaactgaattttgagtggaaagtg
gggtaagaggtgggaatgaacaatatggtttggaagaaccagaggatggaaggcattaag
ttggctaaggcacttacttattttagagataaagctaccaaggacttgggagtgacatgc
tgtaaaggagttttaggatgaatcttgcatcagtgcagattataaaagggaaagagtggc
agaaagccaggaagtggattattaagaaccaatgatggaataagtacagggaaagagaaa
ggaaagatggatttagccaactgaatctaggctgcacactattaaagctcagggtggagg
ccagtcttggctcatgaacttctgagtgtcggaagtgtgctatatcaatggcaggatttt
cgctaacaccagtagagcttgcctctatgactggagtttggtagtactcgctgccacata
gagtaaacttgagaagaatgtttgcacagccaggtcaagtgttacaaatccttctgccct
cacttagGCATCTATATCATAAATCTCAAGAGGACCTGGGAGAAGCTTCTGCTGGCAGCT
CGTGCAATTGTTGCCATTGAAAACCCTGCTGATGTCAGTGTTATATCCTCCAGGAATACT
GGCCAGgtttgtggaacagtggttagtttttatattatagaaataaagcttacagacatt
gtgagacatagaaagacataagaaaacagaaataactcaggccgggcgcggtggctacgc
ctgtaatcccagcactttgggaggtggagtccggcgtattacgaggtcaggagatccaca
ccacggtgaagccccatctctactaaaaatacaaaaaattagttgggcgtgggggcgggt
gcctgtagtcccagctactcaggaggccaaagtggagaatggcgtgaacccggtgggcgg
agcttgcagtgagctgagatgcgccactgtactccagcctgggtgacagagccgagactc
tgtctcaaaaaaaaaaaaaaagaaaatagaaaactcaaactccactgttaagagatctta
agttggactgagccatagaaatcgcccttatgacctatgaccttcctttttttttttttt
tttttttttccttcaagacagtctctcgctctgttgcctgttgtccatcctggactgcag
tggtgtgatatcggctcattgcagcctttgcctcctaagctcaagggattctcctgcctc
atcctcccgagtagctggaattacaggcatgtgccaccatgcctgactgatttttgtatt
tttagtagagacatggttttaccatttggccaggctggtcttaaacgcctgatctcaagt
gatcctcccacctcggcctcccaaagtgttgggattacaggcgtaagccactgcgcccag
cctgtaagaccttttcaacatacatgctgggcatctggcagtatgttgaactttataatt
tcattttgtgtagacttgtgccactaaatatctagaaattctattaaagtggcttatcac
attttcccatagtcaaagtttttaccttaaaacaatgaaatactgggacagaaatttttt
aagaatcttagccagtcatgacggcatgcacccatagttcccgttaattgggagtctgag
ccaggagatccctcaagtccaggagctgggggctgcagtaagttatgattttgccactgc
actccaagcctggggcacagagtgagatcctgtttcttaaaaaagccagtcatgggtggc
tcatgcttttgtaatatggggtactttgtgaggctgaggctggtggcttgcttgagccca
gaagttcgagaccagggtgggcaacgtggcaaaactccgtctctaccaaaattaacaaaa
acgagctgggtgtggtgttggcgtgcctgtagtctcagctgaggctaaggtgggaagatt
gctagaacacaggaggttgaggcagcagggagccaagactgtccactgcatcccagcctg
agtgacagagtgaggccttgtctcaaagagaacctctgccaacttgaatgaaaaatacct
taatttgtatttttaagaaatgactagttagtaaaacttgaatcttttttgccacagctc
tattttaataatttttctgttgagaaaactagtagatttcttgaattctaagagttctaa
cagggattttattcatcttaactattttgacagatttaaaaattatgtagtaagacttta
tttcaatgttgacaggacgggttcccatgtgtgtttttgcagagggttattcctgaaact
gacttgttactaggaccacatagtttggtacacagtagaaaaaaggcagttagttattgc
tgtagaatgaactgagtgacagttcttgcttgcttgagaaaaatatactgagcatctaga
ttgggccaggtagtgttgctaggtgctcgggatatatagtagaaaaacaagcctgtcttt
tttaatgtatgcaggaaatctctggagaagtaagagaggttaaggaaagctgggtatgtg
cctgctttacatggagtagtagtgattaagttggccagtgcccagaagtgcttactgggt
gccaggattgttgctgtggaatatcgagtaccactaacttttaaattcttcaaagAGGGC
TGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTCCAATTGCTGGCCGCTTCACTCCTGG
AACCTTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCACGGCTTCTTGTGGTTACTGA
CCCCAGGGCTGACCACCAGCCTCTCACGGAGGCATCTTATGTTAACCTACCTACCATTGC
GCTGTGTAACACAGATTCTCCTCTGCGCTATGTGGACATTGCCATCCCATGCAACAACAA
Ggtaatgattttaggatctagagtttgtgaatgcgtgctctagaaaaaacattcctgtgc
acattgttagagcttggagttgaggctactgactggccgatgaactcgcaagtgtaggta
gtgtgctacatgaggggcaagttttcgctaacaccacaagggtctctggcccaatgagtg
gagtttgatagtaattcttgctacaagtataacattactgcatgacagctttgtggagaa
atgaaaacatttggaaaatagtgtgttcttctgcctttgtccatgtttcttgctcaggcc
tcaggcacttggcctttgttttcacaccaacttgatgggttctactataagatgctaaaa
aggtgggttgtgtgtggttcagattggttgatttgtaaccctagttgtgcataagaattg
cccagatattttttttaaatgccagtgtccaggcatttttttttcaatccctatgattcc
agtgtgcagacaaggttgaaaatccctatttataatgctccctgttacaattgcttttca
actaagagatgtctgtacttttggtacctagatgatgtaagagccaggaaggtgcttgct
gtttgggtttgaccaagtgtcactttttaataatctgccactcttggcagGGAGCTCACT
CAGTGGGTTTGATGTGGTGGATGCTGGCTCGGGAAGTTCTGCGCATGCGTGGCACCATTT
CCCGTGAACACCCATGGGAGGTCATGCCTGATCTGTACTTCTACAGAGATCCTGAAGAGg
taagcttctccaaaggcttgtggttacataagcaaattggacgacttggactgtgcttct
aggaagcaaaacttgtcagtccctgtaagtctttcctcttttttttttgtaacccagATT
GAAAAAGAAGAGCAGGCTGCTGCTGAGAAGGCAGTGACCAAGGAGGAATTTCAGGGTGAA
TGGACTGCTCCCGCTCCTGAGTTCACTGCTACTCAGCCTGAGGTTGCAGACTGGTCTGAA
GGTGTACAGGTGCCCTCTGTGCCTATTCAGCAATTCCCTACTGgtatgtatcaggataga
ggtgaatcaagctgatattttgcaacttctcagttttattctaactttaatgatctctgt
gacttttatactagctttaagaggttttcattccagtgtgctacagcatctgatagactg
ctgttgggagtggggtaaggaaaaatactacattgaggacagagctgatggctttttttg
gtattctcttaacagAAGACTGGAGCGCTCAGCCTGCCACGGAAGACTGGTCTGCAGCTC
CCACTGCTCAGGCCACTGAATGGGTAGGAGCAACCACTGACTGGTCTTAAGCTGTTCTTG
CATAGGCTCTTAAGCAGCATGGAAAAATGGTTGATGGAAAATAAACATCAGTTTCTAAAA
GTTGTCTTCATTTAGTTTGCTTTTTACTCCAGATCAGAATACCTGGGATTGCATATCAAA
GCATAATAATAAATACATGTCTCGACATGAGTTGTACTTCTAAAgcccactgtagatagt
gtatattgcttttcacttcagaatttccctgagcttccttcctgtgtggagaacatgtgt
gctgtgaaaatagatgtaagtggttacacatacttagttggtaacctcaggaatactttt
ccgaggccctgatgatcttgcttttattaccatttgcgtaggtaagttctatagagctta
ggtttttatttttgagagtcttcctgtcacttaggttaactattcctggaagccctggag
aggcgatggtccttccccacattgagagacattaattgcccctcttgtcagcttgcctac
aggttctgggagaggagaggtatgtatgtatttaaaaatgtgatgttctccatatttgtc
tttgccggggagggggttggggagacagtctttccctgttgcccaggctggagtacagtg
gcgtgatctcagttcactgcaacctctgcctcctgggttcaagcgattcttgtgcctcag
gctccttcgtagctgggatttcaggtgtgcactgccacacctagctaatttttgtatttg
tagtagagatggttctgccaggctggtctccaactcctggcctcatgtgacccgccccaa
aatgctgggattacaggcctgagcctgaccatatttgttttttatgtattaatgctggtg
gcttcatcctaaacggatttcaagattttcattgcctattaaaaaaatactcgtggctgt
catgttggctcacccatgatcccagcactttgggaggcagaggcaaagcgattgcttgag
ctcaggagttcaggaccagcctgggcaatgtggtaaaaccccatctctctccaaaagata
caaaaaattggcagggtgtgatggcatactcctgtagtacctcagctacacaggagactg
aggtgggagaatcacctgaggccaggagttggaggctgcagtgagctgtgattgagcccc
tgtatactctagcctgggtgacga
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1902..2067, 2887..3005, 5035..5280, 5930..6058, 6177..6342, 6555..6823
1935..2067, 2887..3005, 5035..5280, 5930..6058, 6177..6342, 6555..6649
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved