Homo_sapiens Locus RPL32
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPL32
Homo_sapiens
RPL32
3
SNORA7A
2092..2230
8597
acagggtcttactatgttgcctaggccggtcttgaactcctgggctcaagcaaatctcc
cacctcagactcccaaagtattggaattataggtgtgaaccatagtgctcagccaatttg
cacaataatcttaaatacaaaagctaagcaaaacaaatcaagagcatctttaaaaactag
gcagtctgggaggcaggggctgccgtgagccgtgagatggcacctttgcattccagccta
ggtgacagagggaggccctgtctaaaaaaaaccaaaaaccaaaaaacaaaacaaaacaaa
aaacatctaggcagtagctcgtgcccgtaatcccagctactcaggaggctgaggcgagag
aatcgtttgagcccaggagttcaagaccagcctgggcaacagagtgagaccccatttcta
aaaaatgaacaaagaaaaactaggcagtttcgcccagtggttagaagcgtggagtttgga
gtcaagtctccaaatttcatcttccacatatgcaaaatggagacaataataggggtacgt
tatagaattgtggtaggcatagtgaactccatcgcatgttagctgttttcgttactattt
actgtctaaattcggtgatgaaattattaggaagtctctgtcttgttctcttctgaccac
taagaggcgcacttcggagtagaagaaacgcgggcggaaatagcccaaaagcggattggc
ttcgacttctggcggaagtaaattcctccctccaccaggtcttattagctcagaaagaat
tccaaatttctacgtagtcccaaggataggtagaatacatttctcagtcctattcctagt
tattattgtctattaaaacatgtatactcagaatttttgcggcattattttttgacgtgt
ctttattttatttaaaagagccggagccggaagtgcttgcctttttccctgctaggaccc
aggggttacgacccatcagcccttgcgcgccaccgtcccttCTCTCTTCCTCGGCGCTGC
CTACGGAGGTGGCAGCCATCTCCTTCTCGgtaagtgttaatccgtggcaatccgcattcc
tgcgggattcatctggccccgtcgcccagtggtgcggaggcctccccttcagcgcggtag
tgtctgtgggtattgttattgtcagcttactggagcgtgtacaggaacagaacgaagccg
ccgagttgatagggctttgcgtcccagagcctcctgccctccgcctgtattcagagctgc
gggctgcttgtttgttccttggcggtggagggtgctagttgaggccagacttcggggtct
cctgggggccgtgggacgaccaggggtggcccagcttgacagctttcagctgggatctgt
ggatcccagcgctcaccaatgtcggcccacgtgtattcgttcatgccatggccggcttct
tccgctgcagtctctggcccgagggctgctgctgcgggaccgccaaggaaagacgagctg
taggtcggctggtccagctgcaggcagaaattctggtagtatctctgggaatatgaagat
gcaactgcccccaccttgccttcgaggatatcatgggccagaaggcagagtcgttttgaa
tacgtggttcattgagtacccactctgggccagttgatggctgcgaagagagcagaaggg
gtgctgctgtaggaaatcaatggctcggaagaccacactgaggaaggtgtgagttgatac
tggaagatctccaggtttgaggcatcttcagaggtatatggtggttttgtgtgtgttgag
ggtgtggtagcgcagcagctccctagggaattagaaggttttattgaacatttaccctgt
gacaggcactgcaggcattcagcgcgcagtgtcatcttcattttacaggtgaggaaaaga
ctcaggttcaagtagatggtcaaggccagtactaccggaaggaccatctgggggttcgga
cactggtggggtgggatttgctgccccttgcaaattgagagtgtcttggggtcagttttg
atttgctcagctgttggcattctttgggctctgagtgggtgaggtgacccttgacctcct
gggatcgcatctggagagtgcctagtattctgccagcttcggaaagggagggaaagcaag
cctggcagaggcacccattccattcccagcttgctccgtagctggcgattggaagacact
ctgcgacagtgttcagtccctgggcaggaaagcctccttccaggattcttcctcacctgg
ggccgcttcttccccaaaagGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCCAAGAT
CGTCAAAAAGAGAACCAAGAAGTTCATCCGGCACCAGTCAGACCGATATGTCAAAATTAA
Ggtatgtggtcctgggatggaaatgggtgtggggtgaagaaaagagtttccaacagtttc
tgacatcacctagtcaggattatctttgaccgatgaactggcttgtggaagagctttctg
tagaaatacaggtctcccccagtgtgccctagtgctggtacttatgtctcttgatgtgtg
aagcgaaactttaatgaaaagggacatttggccgttttgatgtgttcagagggctttgca
tttgtgtcctgtattttgggttgccttgtgacagcaggatccctattttatagacaagaa
aactcaggtgctgagagcagtgtctgcagctgtgcttgccatctcagtatctacacagtc
ccctcgcatcccattggtgcctcctccattgcttgggagtggcaatggtgggggtgcctt
catccctagtggctaaagccacgagctcctggtttttcccaccaaaaaagtaaggaaata
gtgaagtcctgttaccaaaggcaactactgtgtggcatacttccttttcatttggtcctt
tttttccctccccaaaaggaagagttcgcactctgcacagacgctaacccacctgtgtat
tatttccttcagCGTAACTGGCGGAAACCCAGAGGCATTGACAACAGGGTTCGTAGAAGA
TTCAAGGGCCAGATCTTGATGCCCAACATTGGTTATGGAAGCAACAAAAAAACAAAGCAC
ATGCTGCCCAGTGGCTTCCGGAAGTTCCTGGTCCACAACGTCAAGGAGCTGGAAGTGCTG
CTGATGTGCAACAAgtgagttgggtcccacctctagttttcagtgatcagaagtttgcat
ctgtgtgagcacttctggcaggaactctacaaactcttgggatgcattttggcggggggt
gttgtacattctctgagggaatcagaagttgttccttgcaggattttagagaatgcttgt
tggggaattcaaggtgtttcctttgctgaaggaggtgacttggtcttctaagtgtagaga
cccaagaccaggaaaagactgctttgtgaacactgcaataatagccactttccactacta
caatatcctttggctgttgtttccaaaatgttgctttctttatgaaggtgtcaagcaaaa
gagttgaactctgaaatattcgaagagatttattctgagccaaatatgagttgaccatgg
cccgtgacacagcccttgggagaccctaagaatatgtgtccaaggtgggcggggagcagc
ttggttttacatattttagggagacatgagacatcaatcaaatacacataaggcatacat
tggtttggtccagaaaggcggcacttcgaggttttggatagattttctgtttctcgtcga
gaattggttatcactagaaaggaatgtcttggctacagtaagaggttgtggaaaccaaga
gtgccctattcaaggagggagtgcattcagatggttgctgggggcctttgaattttattt
ttggcttacaagcgggagaaggtcaaacatggacctcagaccttaaggggctcttaagtc
tgtgctgtggtaaggggtatcttcaggggcaggagggctctggaaagtttgcattagatg
gagaacaggaggaaacttggcaggcagagagtgcttacacaaaggtgtagaggtgaaagc
acatggagggtttgcagggcattggttccaggtgggttttattggtttttgttttttaag
atgaagtcttgctctcttgccggggctggagtgcagtggcatgacttcggctcactgcaa
cctccaccgcccagtttcaggcgtttcttctgcctcaccctcccaagagctgggattaca
ggcgtgcaccaccattcctggctaatttttgtatttttagtacagatgaggtttcaccat
gttggccaggctggttttgaactcatgaccttaagcggtctgcctgccttagcctcccaa
aatgctgggattacaggcatgagctactatgcctggcctggtttgattttagagatagac
aggctctgtgttgccctggctacagtgcagtggctgttcacagctgtgatcatggcacac
cgcagccccaaactcaaggtgggctcaagctgtcttcctatctcagccttcctggtagct
aggaccacaggcacactccaccacacccagctagttctaggtgttttgagtaagttagac
acttggtgagctttgtgtataaaagactcagtgacctgcttagattaaaactagggcagt
ggaatgaaaaattctcatgggaagtgacagtttattttcttcacttactggtaaatgaaa
gccaaaaagctgaattttcctaagtaaactagaaagaacatggagtgtgtgtgactaact
aggatgtttgtgtttacgtttacaaagataactttcacctacagtggttgtagatacaag
taataaaaatgaacaagaccagtattctaacgtggttaccttccaagattggaaatttaa
ccaggcgttgaaatgctgaaaatttctgttagaaaagatgggcgaaggaattaatggtgg
atactgaaaccacagttggctgtatgagttgaactgtaacaggcaatacctgttgtatgg
ccaacatgattactcagttgcagtgcacatgttggctggttggcatatgctctgtaagcg
cagcttggcagtctttaagatccatagaaatactctttgacgtttgatctctaagttcca
tttctgggcatttgtccttaaggaatggaaaagcaggcaaactaaagctagtcattgcag
caataacccactggaaacaactgaaaatataatgagagaattgtagagtgctggataaaa
tgttgtgggtccactcaaaatgattcgagtgttgtagtgtggaaaatgcccaagccaggg
gggacacatttaaaatggtgggtacactctgattgtgattatcaaatatatagatggaca
aggacaggagggttttttgaaaagtaaagacagatgagaagtgtaatataacctaagtct
ttaaaacgtagaaacatttaaaaatacaattgctttgaatttgagtggactcatataaaa
caagaattgtctggatttgctgtcttgctgttaaggcagggttcttgaaaagagctgtgt
gtccactgcctcaatcactcctcacagtcctgctgcttctctctttgctgaaaatgcttt
aggggtggaatgtctgttcttaaccactgtgggtggcttcataaatcacctccttactga
agtgtgcttgttaggcctattggttatcaaatggggcacagtgtagctgcctcttaaaaa
gttgtgaggaatgagttagaactggatctgaagtcctcaggtaataggcatggctatgac
tgggtgactttaagcattgttgcttctcaacttgctttgtatcctcagcagtcaaaccag
gtgctcttggctccattcagactcttgggttctgctcttgaccattttgcaaagagttct
gaaccttcatgggcaaggtcaagcaccctgtgactgggggagaacctttgaacctggagt
gtgggcctgggttcgccccggatccctgtccattgcttgctgtgggccttggtttcttta
tctgtaaaatggaggtaatgcctggattacaaggctgctataaggatgagaggggacaat
gagggtactttttaatgaaagcattcttgtcaccaccagggaaccatagtcaggatttgg
gggcatgtaggtgtcattccacagccacttaccaagcagccctctcttagcttggtgctg
ggactcattgcctctccaatggaattttccaagtgtgttgagggctgtcttgctccttac
ctacttgattctcttgcagATCTTACTGTGCCGAGATCGCTCACAATGTTTCCTCCAAGA
ACCGCAAAGCCATCGTGGAAAGAGCTGCCCAACTGGCCATCAGAGTCACCAACCCCAATG
CCAGGCTGCGCAGTGAAGAAAATGAGTAGGCAGCTCATGTGCACGTTTTCTGTTTAAATA
AATGTAAAAACTGCCATCTGGCATCTTCCTTCCTTGATTTTAAGTCTTCAGCTTCTTGGC
CAACTTAGTTTGCCACAGAGATTGTTCTTTTGCTTAAGCCCCTTTGGAATCTCCCATTTG
GAGGGGATTTGTAAAGGACACTCAGTCCTTGAACAGGGGAATGTGGCCTCAAGTGCACAG
ACTAGCCTTAGTCATCTCCAGTTGAGGCTGGGTATGAGGGGTACAGACTTGGCCCTCACA
CCAGGTAGGTTCTGAGACACTTGAAGAAGCTTGTGGCTCCCAAGCCACAAGTAGTCATTC
TTAGCCTTGCTTTTGTAAAGTTAGGTGACAAGTTATTCCATGTGATGCTTGTGAGAATTG
AGAAAATATGCATGGAAATATCCAGATGAATTTCTTACACAGATTCTTACGGGATGCCTA
AATTGCATCCTGTAACTTCTGTCCAAAAAGAACAGGATGATGTACAAATTGCTCTTCCAG
GTAATCCACCACGGTTAACTGGAAAAGCACTTTCAGTCTCCTATAACCCTCCCACCAGCT
GCTGCTTCAGGTATAATGTTACAGCAGTTTGCCAAGGCGGGGACCTAACTGGTGACAATT
GAGCCTCTTGACTGGTACTCAGAATTTAGTGACACGTGGTCCTGATTTTTTTTGGAGACG
GGGTCTTGCTCTCACCCAGGCTGGGAGTGCAGTGGCACACTGACTACAGCCTTGACCTCC
CCAGGCTCAGGTGATCTTCCCACCTCAGCCTTCCAAGTAGCTGGGACTACAGATGCACAC
CTCCAAACCTGGGTAGTTTTTGAAGTTTTTTTGTAGAGGTGGTCTAGCCATGTTGCCTAG
GCTCCCGAACTCCTGAGCTCAAGCAATCCTGCTTCAGCCTCCCAAAGTACTGGGATTACA
GGCATCTTCTGTAGTATATAGGTCATGAGGGATATGGGATGTGGTACTTATGAGACAGAA
ATGCTTACAGGATGTTTTTCTGTAACCATCCTGGTCAACTTAGCAGAAATGCTGCGCTGG
GTATAATAAAGCTTTTCTACTTCTAGTCTAGACAGGAATCTTACAGATTGTCTCCTGTTC
AAAACCTAGTCATAAATATTTATAATGCAAACTGGTCAtttttgggattttgtttttgag
actcattctgtcaccccggctggagtgcagtggcttgatcttggctccctgcaacttctg
cctcctgggttcaggcgattcgattaacaattggagacgagtcgtgcagaggaaagaagt
aacttagaatctaatctttattaacctgggatatcacagaaaatacttgggcctgccact
tgtatttctttgtcctcaatactgaacactagacacatttgaaaccttcctcagaaggaa
acaaaccaactggttatgcctgggtggtggcatggaagatgcccattgttgcccaatttg
ctaataagtattttgaaattagaaatgaaacatgaggtccaagcctgtccagttccctac
ccaacccattcctcctccctggaaaaaagaaacccgtatcatcttccaaatttctgattc
atcactgccacttaaaaatgaaccgttttgaattttaaaatgtgaataactcaagtatct
tttcttttgagatgcccggcctgagcactaacttcaggcattgctgaatgcagtgaagaa
accagagtggtgtctgctgcctcctgatcttttacagctgacagcacagcctatttctaa
atactactagtttgtgaggcagagacaccctctgaaggaaccagacagactatggagggg
tacagtgtgaagtcactggaaaacttcctcaccctatttctttggatgactgtcctgagt
taaggaaggggcccaactgttggcagcctcacagcttgggctgggggcctttgagttggg
tccctggagaaggcactgtaagccctgaccaggagcgacagggcccccagtgagatggtg
gaagggcaaaagtagagacctgcgatggtgggatggggaggcctcggacttgggtgggct
cctttctcttaagcgagggcccaccttggtgctgaggggactagctgagctccattgagt
ctgtgctgggggctgaag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1048, 2300..2400, 3012..3193, 6319..7597
2305..2400, 3012..3193, 6319..6448
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved