Homo_sapiens Locus TPT1
snOPY snoRNA Orthological Gene Database
Homo_sapiens TPT1
Homo_sapiens
TPT1
13
SNORA31
4604..4733
6340
GTGTAGAGACAGGGTTTCAGTAGTTGCCTCCCAAAGTTCTGGGATTACAGGCATGAGCT
ACCATGCAGGACCTGTTTTGTTTTAATACTTAGTAATTGGGTGTAAAGTCCTTCAAAAAA
CAGGTGGGGCAGGTGGGAAACTCCCTTTGTGTGACCCTCTAGCACCAGGGATAAAATTTC
AACTTCATCTTAAAGCGACAACATACTTTTCCAAGACCAAGTGCGAAATAGTAAAGGGAA
GAGCTAGCTCCGTAGCCGTCCGCCACAGAATGCCACAAGCTTTCAATTATGGGACAAAAT
TGGAACACATGGAAACCCTGTGCAGACTCCCGTGACATCTTCCCTCCTCTCCAAGTCCCT
TCCCACAGACCTTGCGCCCCACACGATTATTCCCCAGGGGCCGAGCAGGACGACTTGGGT
CCCACTATCCGGACTCAGCGGTGCCCCCACAAAAGCGTCCCAAAAACTCCAGCTGGGGCA
GCCCTGGGGCAGATGCTGAAAAGTTGTCAGAGGCCCTCGGGCAGTCCCGAGATCTACCCC
AGGCCAGAGGGCCTGACCCTCCCTAAATGCGACGTTCTCCTACCTTGGTTGATACTCACG
TTCCCAGAAAAGGGTGGAACCTAGGCTGGACGAGGCGCAGGGCCAAAGTTTAATTCCTCT
AAGCTCCACCCAGCTCCCAGCACCTCTCCAGGCGGCCCCGTGGGGTAGGGCGGAGCCGGG
TCCAACGTACTCCGCTTCCCCCGCTCCACCCACCCAGGGCTAGGGAGCGCCCCGAGAGTT
GGCCTCCTCCCACGCTGCGCGCGCACCTCCCCGCCCCCACCCCTACCCGCTGGCGTGCCC
AGTGGAACGGAGCCTTGTGTCTCCGCCTCAAGTCCCCGGATGCTCACCTCCCCGACTCGC
CCCCGCTGTGGCCCCGCCCCCGCGCGGCTCTTCGTGCCACGTCACCGCCTGCGTCGCTTC
CGGAGGCGCAGCGGGCGATGACGTAGAGGGACGTGCCCTCTATATGAGGTTGGGGAGCGG
CTGAGTCGGCCTTTTCCGCCCGCTCCCCCCTCCCCCCGAGCGCCGCTCCGGCTGCACCGC
GCTCGCTCCGAGTTTCAGGCTCGTGCTAAGCTAGCGCCGTCGTCGTCTCCCTTCAGTCGC
CATCATGATTATCTACCGGGACCTCATCAGCCGTGAGTCCTCACTGCACTATCCTTACTG
CCGCACACGGGGGTCTGGGGTGCGGGTGGGGGCGGGGAAGGCGCAGCCGTCGCGGGCCTA
GGGGACGCCGGCGGTCTTAGCCGAGCGCGGAGGGGTCGGTGCCCGGGGCTCGCGCCCAGC
TCTGGTGTGCTACGGAGGGGCAGATCCCGCGTGCGGCCGCCGGCGCGGGAAATGCGGGAA
ATGGCGGCGCCAGGCGCACGGTGATGGGCGGCTCTGTGTATCCGGCAGACGATGAGATGT
TCTCCGACATCTACAAGATCCGGGAGATCGCGGACGGGTTGTGCCTGGAGGTGGAGGGGA
AGGTGAGTCGGTCGGGCCTGCGCGTGGGGGAGTCCGGGCCGAGCGGGCTCGGGTTTCCTC
CGCTCCCCCGCCTGAGGTTGTGCAATCCTCCCCGCCGCCTCCTGGCGGAGGAGACGCTCT
TTCCGGGCTTGGGTTTTTCTAGAAAACTGGAGGCGGAGCTGATCCTGGAAATAGGCCCGC
CGCCTCGGCGCCCATCCTCCTCCCGGGGTTGTCCGGGACATGATGCTTCCGGCTTAGGAG
CCTGGAGTCCTTTCGTGTTTGTCCTGTCCCCACTTACCAACCGGAGGCATCACATGCCCG
CAACTGGAAACAACTTTTTAATGACCCCATTTTTTGTTCCGGCCAACAGACAACTCTTTT
AAGTTAGGTCGTTTTGAGAAATCCACGGGTCACAACTTTATTCCCAAAATGGTGCTTTTT
TTATTTTCAGCAAGAACTAAGAATACTTCTTATCCGTGAACTATTGGCGTGGAAGGTGCT
TTGGATGCGTTTGTGTCTTTTGCAATTATACTGCTTTTTCTTAATGCAGATGGTCAGTAG
GACAGAAGGTAACATTGATGACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGA
GGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTGTCATGAACCATCACCT
GCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATC
GTAAGTGATACTGGCAGTACCTAGCTGATGTCTAGAATCTTACAGGATTTAAAGATTGGC
TAACTTTTGAGGTTCTTTCGCAGTGGGTATACTTTTGTGAAAGTCCTTGCTTTTTTATTA
ATGAGTTCACGGAAAAGAGTGGTTGCTTTTCTATAATATGAGCATACTGAAGCCTGCAGT
CTGTTTCCGTTTAGAATTAGAATAGTATTTTGAAAATAGTCAACAAGAAATGTAAACATT
CTTGAAAGATACCTTCTGTGAACTAGTAATTTCTTAACAGCTGGTTGCCTTTTTCAGTGT
TTTCTTTTTTTAAGCTTGGATATTTTTTACTTTAAAAATTGATTTTACTGAAAATTCAAT
ACTTCAACCTGTTAATGAAATGTTGTTTTAGAATCAAAGGGAAACTTGAAGAACAGAGAC
CAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTA
ATTTCAAAAACTACCAGGTAAATACCTTAAGTATCTGGATCAAAGGATTGTACAATTTTA
ACTGCAAGAGCAAAAATTAAGTTGATTAATCTTCAATTCTATACTAGTATTCCAGGTGTA
GAAAGTGGCTTTCCCAGCTCGCAGGTGTTTCCAAATCTTGTCTTCTGATTGAAAATTTGC
TTCCCAGATGACATTTCTCAGTTTTTCTTTTTGTGAATTGCTTAACCACCTAAGTGTTCT
TTCAGTTTTTTGCTTACAATTTTAATGTGTCTCATTGCTACTGGTCCTCCTTCTAATGTA
TCTGAGCTTGTTAATTCTACTTTTGGAAAATGTCAGTGGCTTTCCCTTTCCTCTAATTTT
CCAGCTTCATGCATCCCCTGGCCATAAGATACTTCCAGACTGTATGATATATTCTATCAC
TGTCAGCCTTATGTTCCCTGTGGTTGACTATATAAGCACGCTTTAGGGTTTGGGATTGTA
TTTAGGATTGAGAGTAAAGGTTTCCTGAAAGCCTAGTGTTCCTGGATTGCTCTGTACGTT
ATTTTTCTATTTAGGTCACTATTAAGGTGCCTTAATCCAGTGAACAGATGTCTATGATAA
GTGAGCATCAGAGCTTTTGGGTACTGAAGTTTTGATTTTTGTGGTGGTCTAAACCTTCCC
TTGTACTGTAGTTTGTTTTGAATGGCATGTATTTGTATGTAATAGTCTAATTCTAGGTAT
TTTGTTTGCTTCCCAAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTC
TATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAG
AAATGGAAAAATGTGTAAGTACAAGGAAGTGGGTTAAAATAAATAATGTAAAAAAGACAT
TTTAGATGTGATTTGCAATTGTTTTGTGACACTGAGAATGAGTTTTACAGCGTTCTGAAA
CATGGTTTTAGTTTTCTCTTTGGGGATCAAGAGAATTGTGTTTCATATGTAAAAAATTCT
TAGGGTATAAAAAGGCTTAGAATCTTATTTGTGGAAAACGTTGAGTGCAGATGGGGCATA
ATAAAGTACAGTTTAGGCTGGGTGTGGTGGCTCACACCTGTAATTTCAGCACTTGGGACG
CCGAGGTGGGTGCATCACCTGAGGTTGGGAGTTCGAGACCAGCCTGGCCAACATGGCGAA
ACCCTATCTCTGCTAAAAATACAAAAATTAGCCAGGCATGGCAGCGGGCACCTGTAATCC
CAGCTAATCGAGAGCCTGAGGCAGGAAAATCACTTAAACCTGGGAGGGGGGTTGCAGTGA
GCAGAGATCCCACCACTGCACTCTATCCTGGGTGACAGAGTGAGGTGCTGTCTCAAAAAA
ATACAGTAGAGTTTAAATGCTGAAGGAGATCAGAGAACACCATTGATCTTCCTCTAGATA
TGGCCTCACTTTCACTTCATAATCATATTTTGCTGTATACGTATGGATCAGTATCAGTGG
TTTTCACTTTGGTTTACTGATAATGGGCAGCTGATCATTGAAAAGCCTAGTGCAGTACTA
GCTTAGTAAATAGAGCTGACTGCTGAACTGGTATGCAAATTGTTTTACTAATAATAAATA
ACTTGGTGTCTTCTATGGAAGGAACTGCTGGAAGCTGTACAGAAACAAAGGCATTCATTA
TCCTAGTTTTCATAGGCTTCTGTATAAGGAAGAAGAAAAACATAAAGCTATACTGAACAA
GATTAGAGTCAACAGTAGACAGAAATTACTTAGAACAGTATAAGATGACTTACCAAAGGG
GTTATTCAGACAGTATCTGAGGTTTTTGTTGGTAGAGCAGGGTGTGGGTGGTACATGCCA
CAGCCTTCTGAAAAATGAGCTACCGCTGATTTGGTAAGGGTGTTCTGCATCCACTGATAG
ACCTTGAACAATTTACTGTTGTTCTTTTGGTTTGCACTAGGATGCAAAAGAAAGAAATCC
CTGCGCTTTCTGTCTGTCTTTGTGGCGGCCCAGATTGAATTGGGGAATACATCTTTAGCC
TGGAAATGTAGGCTGCATGTTAATGGTAATGTAACTTTTGCAGTGTAATGTTTGAAAAAT
ATTAATGTAGTTTTTGCTTTTACAGTAACAAATGTGGCAATTATTTTGGATCTATCACCT
GTCATCATAACTGGCTTCTGCTTGTCATCCACACAACACCAGGACTTAAGACAAATGGGA
CTGATGTCATCTTGAGCTCTTCATTTATTTTGACTGTGATTTATTTGGAGTGGAGGCATT
GTTTTTAAGAAAAACATGTCATGTAGGTTGTCTAAAAATAAAATGCATTTAAACTCATTT
GAGAGAATGCCTTTTAGTTTAATGCATATTTAAACTAAATTGATCCTGTAGTGTTCCTGG
AGAAGCTAGAGCCTGATTGTAGGCTACTACTCATCAATTAACTTCTACAGTGGAGACTAC
TTCTGGGACTGGAATATAAAAAAGAATCAAAGGTTCTGATTTTGAGTTGCAATAAAGGGA
AAGACCATGCTCATAGCAGTGCCAACATCTGAAGTGTGGAGCCTTACCCATTTCATCACC
TACAACGGAAGTAGTTAACTGGAAGAGATTACCAAGAGAATAAAAAGAGACTCATTCAGT
GGAAGCAACTTTGTCTCAGCTTATTTCACATAAAGAGAGCGAAGTCTTTTGGGATGAATG
TTAATTAAACTCCCTGGTAACTAGAACAGGGACTGGCAAACTAGCCTATCTGACCACCTG
TTTTGTACACTTTAAGGTGGTTGGTTGCCTTTTTAAATGGTTGAGGGGAAAAGAATACCT
TGTGGGATATGGAATTTAAGTTCGAGTCCAGTTTTATTGGAACGTGGCTATGCTTATTCA
TTTATGGATTGACTGTGGCTGTTGTCAGTGCATGAGCAGAGTTGTGTCTAACAGACTAGA
GCCTGCAAGTTTGCCAGCCCCTGATTTAAAAGATGAAGGTACACAGAATGTGGGCTGGCT
GGTGGGCAAAGGGGTAAAAATGTTCTCTATATTGTATCTGAAAAGATGGGGTGTCTGAAT
AAGAAAATGCATCTATTTGACAGACCTGGAGCAGTTGCTATCTGCTGCTATGGTTTCCAC
CACAGATGCAAGAAGAACATGTCCTTGCGCTTTCCGTCTGTCTAATTGTGGCAGCTGAGA
TTGAATAGAGGAATACAGGAGGAAAAAAAGCGGGAAGAGTTTTTGAGGCAGGTCGGTCAC
CCAGGCTTGTAGTGCAGTGGCACAAGCAACTCACTGCATTCTCTGCATCCTGTGCTCAAG
CCATTTTCCCACCTCAGTCTCACTAGTTGCTGGGACTGCAGGCATGCACCCCTATGCCCA
GCTAATTTTTGTAGAGACCGAGTATCGCTTAGTTGCCCAGGGTGGTCTCAACTCCTGGGC
TCAAGGAGATCTGCCCACCTCAGCCTCCCAAAGTGCAGGCCTAGCCTGGGAGGGGAATTT
TCAAAACGTGAGTTTTGGGAAATAGTCTATCAGCCTTACCTGGTTGATTACACTTGTAAA
AGAAAGATTAAAAGCAGGCCAGTGACTCTGGTCTGCTTGAACATGTGAATGTAGTGGTTT
GAGCAATCTGGAGTTTGCCCTAGTGTCAAATTCCAGACTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1171, 2029..2219, 2611..2716, 3437..3553, 4825..5340
2029..2219, 2611..2716, 3437..3553
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved