Homo_sapiens Locus RPL13
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPL13
Homo_sapiens
RPL13
16
SNORD68
1749..1820
4759
GAACTCCAGCCTGGGCAACAGAGGGAGACTCCGTCTCAAAAAAAAAAAATAATAATAAG
TTTTACCAGGAGGAAGCGTGGTGATTGGGTGAGGGTAGGGAAGAAAGAGGGTTATTGGGA
TTTAAAGGTTTCCAGGTAGCAGTAAGATGGATGGTGCCTTCACAGACTTATACTAGAGAA
GAGATGGCTTTTTGTTGATGCTTTTCTTTGTGAAGGAAGGCAGTAGGCACAGCAGGTCAG
AGTGTGACATTTTCAGTCGGGTACCCCTGACCTTAGAGAAGTCACCTAATCCTGGGCCAA
GGGAAAGCGACAGAGGCCAACAGTAACTCCGTCTACTAAAATACCAAAAATTAGCAGGGT
GTGGCGGCGGGCGCCTGTAATCCCAGCTACTCGGGAGGCTGAGGCAGAATTGCTTGAACC
TGGGACGCGGAGGCTGCAGTGAGCCGAGATCGCGCCATTGCACTCCAGCCTGGGCGACGG
AGCGAGACTCCGTCTCCAAAAAAAAAAAACAAAAAAAAAAACCACAAATGTTCTAAATGG
ATGGGAGGAGAATAAACGCTGGAACGACAAGGACGAAGGCCTTAGGTTGCGCAAACTCGG
ATGTCACTGAAGTTTTTCTGCCTTTGCGCTGCAAACGTGTCTCACAAATGTGAACAAACA
GAATTCCTCGGGCGTCGCCCGTTCGCCGTCGGCCCAGATACCGGACTCGCGCGCGTTAGC
CCGCAAGACAGGACTCGGCCGCGGCCCGCGCAGCGGCTGAAGCGCCGGGGCAGTAACGGC
GGACGTCAAGCAAGTCCGGCCGTCGGTTACTCAGGGCCCAGGAATCACGGCCGCCCCGCC
GCATTCTCAGCGGCAACATGTCTGCGACGGCGGCCCTAGGGCTGCCGGGAGAGCCGCGGC
GACGTCAGTTCCTCCTTTCGGGGCTCTGATTGGTCAGAGCGCCCGGCGCTTCTGGTTGGC
CGGCCCTGCTATCATCCCAGAGTGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTT
CCTGCGCAGGAGGTGAGGGAGACTGGGTCCTGGCCTTTGGGCATCATCCAGCGCCATCGG
CCTGGCGCTTCAGCCAACGCGGGAGTGGATGGGCCCCTTCTTCTTCGCAGACAGCGTTCG
GCCGCTGCCCGGGCTCTAGGCGCGGCCGGACGGCCCAGTCTGGAGGGTTCGGGGCGGAGG
CCCGGGGGGGTGCGCGCGCCCGGGGTCCGGCCTCTCACTCGCTCCCCTCTCGTCCGCAGC
CGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAATGGCATGGTCTTGAAGCCCCACTT
CCACAAGGACTGGCAGCGGCGCGTGGCCACGTGGTTCAACCAGCCGGCCCGTAAGATCCG
CAGGTGAGCCCTGCGCTCGGGGCTGCCCCTGGGGCTCGTGCCCGCGGCTGCGCCTTGGCT
TGCGGGTGGCCGATGCCAGGGCGGGGGGCGCTGTCTGCAACCGTCGCGGAGCGCTGGCCT
GGCGGCCTTAGGCAAGGGTGACCGCCGCTGCGCTTCTCTCCACCAGACGTAAGGCCCGGC
AAGCCAAGGCGCGCCGCATCGCCCCGCGCCCCGCGTCGGGTCCCATCCGGCCCATCGTGC
GCTGCCCCACGGTTCGGTACCACACGAAGGTGCGCGCCGGCCGCGGCTTCAGCCTGGAGG
AGCTCAGGGTGAGTACTGGCAGCGCTGCGGTGTCAGGAAGGCCCCGAAGTCCCCTCTGTT
GGCCTCAGTCGCGTGATGACATTCTCCGGAATCGCTGTACGGCCTTGATGAAAGCACATT
TGAACCCTTTTCCATCTGATTGCTGAGGCTTTTCATCCAGGCCTCGGGGCTGGAGAAAGC
CCGGGCCTGTCTCCATCTCTCTCTGGTTCTGGGGCAGGTGGCCGGCATTCACAAGAAGGT
GGCCCGGACCATCGGCATTTCTGTGGATCCGAGGAGGCGGAACAAGTCCACGGAGTCCCT
GCAGGCCAACGTGCAGCGGCTGAAGGAGTACCGCTCCAAACTCATCCTCTTCCCCAGGAA
GCCCTCGGCCCCCAAGAAGGGAGACAGTTCTGTGAGTACACGGCTCTCTGGCCGTCCTGG
TGCGCGGGGACAGTGAGGCTTGGCTCCTTTATCAGTGACACCGGTCCCTGGGTCTTGCTG
GGGTGAGAAGAACCAAAACATTGTGGGTGATGAGCTAAGCGGGACTGCTAAGGTTCACCT
GTGCGTTTCCGCAGAGATAACCTTAATGGACATGGCAAGGCTGTGTGACTTGGAGGCAGC
TTTTTCCATTGACGTTGCTCTCCCTAAAATGCTTCGTATTCCAAAATATTTCTAGAAAGA
CCTTGTAGGATAAGGTTGATAAAGAGTCCATTGTATACGTTTCCGGGTAGTTAAATTAGG
GAACAGTTTTCTCTGCCCCGCCCGTGGTTCACAGGTAGATAACTGTCTCGTGCGTGTTGC
GTCAACTCAGTAAGATATAGTCACCTAACTAATAAGGACTGTTCTTAACATTGGGGCCAC
AAAGTGTGTTGTAGAAAAGGCTCAGACACTGGTCCTGAACACGGAATCCCCAGGGGAAAG
TTTGGGGCCAGGTGAGGGTGGAGTCCTTGCAGCAGTGCGGCCAACCCCACTTAACTCTTC
TCATTCACCAACAGGCTGAAGAACTGAAACTGGCCACCCAGCTGACCGGACCGGTCATGC
CCGTCCGGAACGTAAGTGAACACTTACTCAAATCCAGGCTTCAGACGAGATCAGTGGGTG
AACACGTGGGTATCTGAGATGCGGGTGATGGGGGTCAGGCTTAAGAACGTTAATAGTGGC
AGTTGTGGGTGTGGAGGTTTGCGGAAAGGAACATTTCTTCTTAGTTTTTACTTCTTGCAA
CCATGAAGCCATACATTGGGAAGTATTTTTGTTTGTTTTGTGTTTTTTTGTTGTTGTTGG
AAAGAGAGTTTCTCTATGCTGCTTACATTGGTTTTGAATTGCTGGGTTTACAGGCTTGAG
CCGCCATGTCCAGCTCAGGGAGGGTTTTTCTTTTTTTTTTTAAATCCCAGGGAAGGTGAT
TGACTCAGGGTTGCTTTTCAGCAGTACTTATGGCAGCGAACCTGACCCCCAATCCCCGGG
AGGTCCTCCAGGTTCTCCTGACGCTTGGTTGTTCCCTTGCCCTTTGGTGCATGTGGGTTT
AACAACCTGTCTTTCTCTTCTAGGTCTATAAGAAGGAGAAAGCTCGAGTCATCACTGAGG
AAGAGAAGAATTTCAAAGCCTTCGCTAGTCTCCGTATGGCCCGTGCCAACGCCCGGCTCT
TCGGCATACGGGCAAAAAGAGCCAAGGAAGCCGCAGAACAGGATGTTGAAAAGAAAAAAT
AAAGCCCTCCTGGGGACTTGGAATCAGTCGGCAGTCATGCTGGGTCTCCACGTGGTGTGT
TTCGTGGGAACAACTGGGCCTGGGATGGGGCTTCACTGCTGTGACTTCCTCCTGCCAGGG
GATTTGGGGCTTTCTTGAAAGACAGTCCAAGCCCTGGATAATGCTTTACTTTCTGTGTTG
AAGCACTGTTGGTTGTTTGGTTAGTGACTGATGTAAAACGGTTTTCTTGTGGGGAGGTTA
CAGAGGCTGACTTCAGAGTGGACTTGTGTTTTTTCTTTTTAAAGAGGCAAGGTTGGGCTG
GTGCTCACAGCTGTAATCCCAGCACTTTGAGGTTGGCTGGGAGTTCAAGACCAGCCTGGC
CAACATGTCAGAACTACTAAAAATAAAGAAATCAGCCATGCTTGGTGCTGCACACTTGTA
GTTGCAGCTCCTGGGAGGCAGAGGTGAGGGATCACTTAACCCAGGAGGCAGAGGCTGCAC
TGAGCCAGGATCACGCCACTGCACTCTAGCCTGGGCAACAGTGAGACTGTCTCAAAAAAA
AAAAAAGAGACAGGGTCTTCGGCACCCAGGCTGGAGTACAGTGCCACAATCATGGCTCAC
TGCAGTCTTGAACTCATGGCCTCAAGCAGTCCTCCCTCAGCCTCCCAAGTAGAGGGGTTT
ATAGGCACGAGACCCTGCACCCAACCTAGAGTTGCCTTTTTTAAGCAAAGCAGTTTCTAG
TTAATGTAGCATCTTGGACTTTGGGGCGTCATTCTTAAGCTTGTTGTGCCCGGTAACCAT
GGTCCTCTTGCTCTGATTAACCCTTCCTTCAATGGGCTTCTTCACCCAGACACCAAGGTA
TGAGATGGCCCTGCCAAGTGTCGGCCTCTCCTGTTAAACAAAAACATTCTAAAGCCATTG
TTCTTGCTTCATGGACAAGAGGCAGCCAGAGAGAGTGCCAGGGTGCCCTGGTCTGAGCTG
GCATCCCCATGTCTTCTGTGTCCGAGGGCAGCATGGTTTCTCGTGCAGTGCTCAGACACA
GCCTGCCCTAGTCCTACCAGCTCACAGCAGCACCTGCTCTCCTTGGCAGCTATGGCCATG
ACAACCCCAGAGAAGCAGCTTCAGGGACCGAGTCAGATTCTGTTTTGTCTACATGCCTCT
GCCGGGTGCCGGTATTGAGGCACCCAGGGAGCTGTTACTGGCGTGGAAATAGGTGATGCT
GCTACCTCTGCTGCTGCACTCACAGCCACACTTGATACACGATGACACCTTGCTTGTTTG
GAAACATCTAAACATCTAGTAGATGACTTGCAGGCTGTTGGCTACCAGTTTCCTGTCTGA
GGTGTATATGTTAACTTCGTGATCAGTTTGTATGTTTGGGACTCTTGTCCTATGTAAAGT
TAAGGTGGGCCGGGTGCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1031, 1259..1382, 1546..1687, 1897..2070, 2654..2710, 3203..3759
1279..1382, 1546..1687, 1897..2070, 2654..2710, 3203..3358
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved