Homo_sapiens Locus RPS2
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPS2
Homo_sapiens
RPS2
16
SNORA64, SNORA10
2721..2854, 3361..3493
4766
ctggaagcctctgagcttcccatccttgctagtgctctgctggctccacctggagccct
ttggaccaaggcattttacctgccagtgtagttcacttgagatgcgcatggccacaagac
tgttcgtagtctggctcctccacttaagaggcgtcggaccttacacatcacctgccaacc
tcccatatcctacccttgtgtccaaagccaggaaagaagaggaggcatctcgctagggtt
ctccccgccacagcgtgaacatatgcacttgccgccaggctgataggcgagtcggggccc
caagaacacccgcatgcagtgagttagacaaaacagctttatttgaaagacgtgggacag
ccaagttcccccaaccccgcggtcctggcgacgtcggtgtcaggcgtgggaggaccagtg
tcctgcggagaaagaacaaggttaggggtctgcagtcggggtcaggagtcaggggccaga
cctcgcgagcgaccgcacccgggggggaggcggcagcgcctgtcggggcctgggtttcac
cgccgcacatggggcagcgcgcggtgagctgaggcccccgggggctctgggcgccgaatc
tcacccgcggccacggccaaagccgggggcgattttcaaccaacgccggtctcgaagacc
accagcgagacgccagtggtcaacgcggcaggacctacctaagtgaagaggagagcgcaa
tggaggcgcggacgtttatagccactcttcgggtggattcccgagccgcggctggggacg
gaggcgccggcgtttatagtcgcttttcgggtgacgtagattcccgggccgcggctgggg
ccggacgggcaagagcactcagagcccggtgagggcggggcaccgcggagccaatcacag
gttgtcttataggagctcggcccgctcccgcttggggcggggctgcggagatctcgcggc
gcttggcgtgctataaaagctgcttcccagtaggtctcgttCTTCTTTTCCGACAAAACA
Cgtgagtcctgttggtcgctgcagcgggcctctgcgtgggcggcgggaatccgcggacat
cgggtcgggtctaggctcccgagtccgcgctcctgggcgggagcccttgtctgggtctcg
cggggggctgccagatgcgtaggccacactgactagttccttcttgtcgcttttcccagC
AAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGGGGCCCTGGTGGCCCTGGGATGG
GGAACCGCGGTGGCTTCCGCGGAGGTTTCGGCAGTGGCATCCGGGGCCGGGGTCGCGGCC
GTGGACGGGGCCGGGGCCGAGGCCGCGGAGCTCGCGGAGGCAAGGCCGAGGATAAGGAGg
taggtatcagccacgctcggggtcgggcccctgggcggcgccggagagcggtcctggtca
ctggcgccttttctccctttagTGGATGCCCGTCACCAAGTTGGGCCGCTTGGTCAAGGA
CATGAAGATCAAGTCCCTGGAGGAGATCTATCTCTTCTCCCTGCCTATTAAGgtacgcgt
cggtcgttggggcgttgagcaagtgcgaccccggagtcatttgggctggggttggaggat
tagcatctgccattgactcgcattaaagggcccagcgtctcgcgtgagaggttgaggttg
tgttgcgggctggctgaggagaggattccacttagaggttggatggatacctgagcgaag
ccagagccacaaaaggcatttcagcgcatcttcccacattcgcagcgaattcatttcgaa
agaactgaaagagaagcagcgcttggttcatgccatccgagaggatgatgaagttcaggt
tgtgggaggacactgtaagggttagcaaactgtcatagtccgcgtgtacgggacagctgt
catctgcatccagcgggtgcagtggggaaaggctaatggcatatttgtcatgtgagcgtt
cgccctagcaaggtacggtggtcatggctaggccaaagctggacaaagcaaaaggaaatc
tgagtggaaagccacatctcaccaaacaagagaaaaagggcaaataggaagaaacgattg
agatgcagaaatagggtaaccttacatacaagcttccaaaaacgaaacgaaggggacaga
tcggggggaagccaggtgagggggttcatgacttcttcggttttttttgggcggggtggg
cggttacacagtttcgccctatcgcctaggctggcgtgatctcggctcactgcaacctcc
acctcccaggttcaagcgattctcctgcctcagcctcctgaatagctggggttacaggcg
cactccaccatgcccggctaattttttgtgtctttaatagaggtggggtttcaccatgtg
gccaggctggtatcggactcctgaccttgtgatccgcccacctcagtctcccaaagtgct
gggattacaggcttgagccaccgcccccggccgtgactttggttcttgaatatcataatg
gtattaagtttttttttaatgctctccctacaattttcttgtttgtttcagGAATCAGAG
ATCATTGATTTCTTCCTGGGGGCCTCTCTCAAGGATGAGGTTTTGAAGATTATGCCAGTG
CAGAAGCAGACCCGTGCCGGCCAGCGCACCAGGTTCAAGgtacccggctgtcctggaggg
ggctgcgctgggcttgccgggactctctcggctctgcatagttgcacttggcttcacccg
tgtgactttcgtaacggggagagagagaaaagatctcctcaggacctcggatgggcctta
ctgtggcctctctttccttgaggggtgcaacaggccctgggcggtgggcagtgattgggt
gtagggccaccagctgcctcacacacatcttttcgcagGCATTTGTTGCTATCGGGGACT
ACAATGGCCACGTCGGTCTGGGTGTTAAGTGCTCCAAGGAGGTGGCCACCGCCATCCGTG
GGGCCATCATCCTGGCCAAGCTCTCCATCGTCCCCGTGCGCAGAGGCTACTGGGGGAACA
AGATCGGCAAGCCCCACACTGTCCCTTGCAAGgtaggctggtggcaggtgatgggcctgc
cgtggggcaggctccctcgggcccccgtctcctgactccttccctcaccagGTGACAGGC
CGCTGCGGCTCTGTGCTGGTACGCCTCATCCCTGCACCCAGGGGCACTGGCATCGTCTCC
GCACCTGTGCCTAAGAAGCTGCTCATGATGGCTGGTATCGATGACTGCTACACCTCAGCC
CGGGGCTGCACTGCCACCCTGGGCAACTTCGgtaggtggtccacacatggggcatagcca
tggtctctcagctccgcttaaccacacgggtccagtgtgtgcttggcgtgttttcaggga
ggcagagaaaggctctcctaatgcacgacagacccgcccagaatggcctctctgttccta
ggagtgcgacaatttttgggttgggggacttgcctcaagcacaccactgaccctcctggg
gttcttttgttttgcagCCAAGGCCACCTTTGATGCCATTTCTAAGACCTACAGCTACCT
GACCCCCGACCTCTGGAAGGAGACTGTATTCACCAAGTCTCCCTATCAGGAGTTCACTGA
CCACCTCGTCAAGACCCACACCAGAGTCTCCGTGCAGCGGACTCAGGCTCCAGCTGTGGC
TACAACATAGGGTTTTTATACAAGAAAAATAAAGTGAATTAAGCGTGttactgttttttt
cccgtgtcctgcatggttagtggtggtttgaatctggggcgtggggccaatagatcacac
cagacacacaggcaggttgcagggctttatatttcagcaacagtcatacagagccacaca
gcaggggcacccacagctgcctcaggaggtggcagcggcggcctcttttgcagcttttct
ctcttgcagcatcctctgcctctgtttggccaggcacttcctggcagaactgtaggcccc
caggtcctgatctggggaagcaatggaaacaagctgggaaccgaggcctctgctacatgc
aaagggggcaaagtcaagtgagcacaagggaggggagggaagatttgcaatggttctggc
ccccaggcctcaggaggatggtggggggttgggggtgggtggggcacgcacagcggtcct
ggtaggccttggccacctgggtgaactgctccacttccttgatacagttctgctggtagt
tctgtccttccctctgctgacaggctttgagccgatcctgcataatgttgataatttctt
ggtcgactttgctggtggagaaaaggagcaagagaggctaatcacaaggaatccttttcc
tgtaccctgtgagaacaattgaaagcaagagccctggggtctggctcctcccatgtcacc
cctaaaatctgggcatgccaccctgtggcatcccagggactagtgtcccagcagcacacg
gtgcagatctccacactcccagcatggctcacgtactagtccctcttccactgcatttcg
gcttcatacatgcacatgatgtcctcctccttgcactcagtgatgtctggcacgcggcgg
tactgccggtggtagtagtaatacctgttctttgcgtgctgccgctctataaattctgca
aagacaaagccacagactcaaatgcctcatcggtttggacaggcttttagctttcttatt
tctcataagccctttggaggggagaga
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1020, 1199..1378, 1462..1551, 2571..2678, 2918..3091, 3171..3330, 3557..3766
1202..1378, 1462..1551, 2571..2678, 2918..3091, 3171..3330, 3557..3729
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved