Homo_sapiens Locus RPL12
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPL12
Homo_sapiens
RPL12
9
SNORA65
3769..3905
5730
GCCTGCAGAGCCAGTTCAGGCCCTCTTGTCACCCCACCTGCCTGCAAGGATGGGGAATG
GTTTGAAAACAGCCCTCCCCCATCCGTCCCTGATGACCAGCACTTACCCTTCTGCTCCCC
AATCACTAACCCTCTTGCACCCCCTTCCTGATGTGCAGCCCTCCCCACTTCCTCCCAACC
ACCATCGCTCTCCCACCCCTCCCCGAAGATCAGTTCTTTCCAGGCTGCCCCACATGCCTG
TCCCTCCCTCTCCGACGTCCAGCCTAGATGCGGGGGGAGGGCCACACCCATATTTCCTGG
GGTGGGGTGGGCAGTGGCTGACCTGGCTTTGCGGATGGAGGGATCCCCCACGTTGGGACC
CGCGGGTGCACCCGAGGGCAGGCCGATCACTCGGAGGGCTTGGTCACGGACTCGGGGCCG
CAGACCACCCGGCACGGGCCGGGCGGAGCCGGAGTCTGGTCTCCTTCAAAGGCAGGTGCT
GGGAACAGAAACTCAGAATCTCATAAAGTCACGCAGACCGGGATGACGAAGTCTGAGGCT
CTAGGAATCGCGGACTCTCCGAATGAAGAGCGGGACTGGATTTCCACATAGACTGTTTTG
ATAACTAAAGTGCACACAACAAGTGCTCGAGGGAGCAGGGGTCGCCGCGGTACTGGGGTC
TCGGAATGGGACTACGGACCCCTCAGGGGAGGGGCGGGGCTCTGGGATTGGGTGACGGGG
ACCGGGGTGACACTCACGATAAAGGAATATGGGAAACAGCTAGGGCTGGGATCACCGGAG
CCACCCTTCTCAGACTTCTCCGGAGCGAACTACCCGAACCCCCTTTCGGAATCTCTAGCT
TCAGCGCACCGCGGTGCCCTGCTTGCCAGCCGTCAGCCTCAGGCGCCTGCCCACAACAAA
CATGGCGACAAGGGCGTCTCTGGAAGGCCGGGCAGTGACGACAGTTCTCGCGATAGCCGC
GTTTTCCTGCCTATATCTGGCTTGTCCGCGCGATTTCCGGCCTCTCGGCTTTCGGCTCGG
AGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAGCC
GCCTCCACCATGCCGCCGAAGTTCGACCCCAACGAGATCAAAGTCGGTGCGTGCTCTGGT
TGTGGCCGGGGCTGCGGGATGGAGCATCCCTCGGCCCTGCCGCGCGTGCAAAGCTTTCCC
CGTATGGGGCTCTTAAAGCCGCTGCCTCCCAGAGACCTTCCCGGTGTTGCGCCGCCCCGG
CCAAGCCTCAGCCTTTCTGGGCCTTAGCTTCTTCACGTGTAGGTGGGGAGGGAGGACTGG
ACCACCTGTGGCGGCTTGGGAGCCCGCACGCCCTAGGGTAAGGCTTGTCTCCGGGCGTTT
CGCCCCATTGGCCTGGGTTAGCGGGCGACGGGGCTCTCTCCACGCCTCCCCGGTGTGAGT
TTCGGAGCTGCCCACACCCGAGGGAGGAGCGGGTGGCCCGCCTCGCGCTCTGTGCTGTTT
CGAGAAGAGGCAGAGGGTGGCGTGTCCAACCCCGGAAAGACGCTGAGAGGGCTGTGGCTC
GGGGCTCCCTCTGCACAGACACTAACTCTTCTTTTCCCCCAGTATACCTGAGGTGCACCG
GAGGTGAAGTCGGTGCCACTTCTGCCCTGGCCCCCAAGATCGGCCCCCTGGGTCTGGTAC
GTTATCCCCTCCAAGGGGCATTTTTTTCACATTTGTTTCACTTTAAGCGCCGGCTCGTGG
AGTCACGCCTGTGCCAGAGGTGCCCTCGTGGCTTGGACTGTCACCCTCAGTAGGCCTGAG
CCACTGAACAAGTACTAGGTACCTTAGGAAGGTCGTGTGTGAAAAATCGAACCTGGTGCC
TTTAAATTGTAATTAGCTCCATGTGTCTCCACTGCTGCTTTAGTGTACCTGAGGGGTGGG
CCCAAGGGGGAGTTTTGAAGTTAGGACTGGCTTAGAGACATTGGGCAGCCAACATCTGTA
TTTCCTCGTCAGGAAGTGGGCATGGCGTTGTTGGGAGATTAAACGGGGTGTGGGTGAAGA
TCCAGTGAGCGTTTCCAGCTGTGTTGTAGATGTAAACCTAGCAGTTAATGTGGCAGGCTG
TGTCTCATGCCTGCTGAGCAACTGCTGGCTTCCCCGTCATTCTGTCCTCTTGGATTTCTC
TGAATTTCATTAGGCCTTTATTTAATCCTTGCACAGTGCTCCCCTGCCCCAAATGCTCTT
CCCCATTGGTCTTTTTTAACCTGTATCTTAACTATTCTTCCTTGGCCGTTAGCTGGCACT
TAAGGGACACTTAGCCTCCTGTTGAGGCTAAGGATTACTAGAGGAGGAGAACTTCAGAGT
AGCAAATAATCAGACCTCCATCCAGGAAGATGGACGTGGGTGGTCTGACATGGGAGCCTA
GTATTTTGAAAGCTCCTTAGGTGATTCTAATGTCAGCAGGGCTGAAAATCCCCCTCCTTA
AGCACATGGGCACTTAGGAGGGGGTCTAGGTTACATTGTGGCCAAGTCTGCAGTTTACAG
TTCTGGACAAGAACCCCAACCCCCAATTTATGCTATGGTGATAGCTGTGCTCTGATTGAG
AAGGTGCCCTTAGGTACTTGAGATAGCTTCCTTTGTTGCCAAGTGAGAAGTGGTGGGCAG
GTTTCAAGGCTGTGGTTCACCTCTGGACACCATGTTGATTACATGCCTTTATTTCTAGTC
TCCAAAAAAAGTTGGTGATGACATTGCCAAGGCAACGGGTGACTGGAAGGGCCTGAGGAT
TACAGTGAAACTGACCATTCAGAACAGACAGGCCCAGGTATTTGCTTGTGCTTGGTTTCG
GGAGAGGAGGGTGGGGGGACAGGTAGCAACCCTCTGGGATTCCTGAAGAGTATTTCTGCC
ACCAGTGGTGAGCCGAGAGTGATTTCACCTTGTTGGGGAGGCTTTGTCAAGAGTACGGAC
CTAGGGCAAAGACTTGGACAGTGTGTGGCCATGATTTTTGAGAGCCAGCGTGCATGGCAG
TATTCACTGGAGGTGGAGTATTCACTCAGGAATCTCTTCTGCAGATTGAGGTGGTGCCTT
CTGCCTCTGCCCTGATCATCAAAGCCCTCAAGGAACCACCAAGAGACAGAAAGAAACAGA
AAAACAGTAAGTTGTCTTTTCCCTAGTTTGGTTTTGGTAATGGTTTGTGAGATGTTTGAT
ATATGTGGCTGTGTTTTCCCTTAAAGGAAACCTGGGGTTGACATGGGTATTGGGTGTTGA
TATGGTTAGGGCTGCTAGAGCCAGGTAGTATGAAAAAGTGCCACGTATGCTGGGTGGCTC
ACACCTGTAATCCCAGCACTGGGAGGCTGAGGCGGGTGGATCAGTTGAGATCAGGAGTTC
GAGACCAGCCTGGCCAACATGGTGAAACCCCATCTCCACCAAAAAATACAAAATTAGCCT
GGTGGTGCTCGCCTGTAGACCTGGCTACTCAGACGGCTGAGGCAGGAGAATCACTCGAAC
CCAGGAGGTGGAGGTTGTAGCAGTGAGCCAAGATTGTGCCACTGCACTCCAGCCTGGGTA
ACAGTGAGACTCCGTCTCAAAAAAAAAAAAAAAAGTGCCATGTAGTCCCTGTGTGGGGCA
GGCCCCAATCAGTGCATGTGGGAGGAAGATGTCAGCAATAATGACCTATAATCAGGAGAC
CACATACAGGTGGCAGGTACTGGGCAGTTTAACTCCCTGGCAATTTAAGCTTGTCATTTC
TCTAAAACAGTTTCTGCCATGTCAGATTTGTGAAGGCTTGGTTTTGCCCTCAGCCACCCG
CCACTGCACCTGACCAGGTCTCTGTTGGCTGGTGCAATCCAGTGGTGAGCTGATAGTAAA
CCCCAGCTTAGGAAACAGGGTTGTTCTTCATGTGGATGACTCTGTGCCGAAAGCATGGGA
ACAGCCTAGAAATGAAATGAAGGACACATGATCTGCTTTGGCTTCAGACTTTAAAAGAGC
TTTTGCTGTTTCCTCTTCTGCAGTTAAACACAGTGGGAATATCACTTTTGATGAGATTGT
CAACATTGCTCGACAGATGCGGCACCGATCCTTAGCCAGAGAACTCTCTGGTAAGAGCAG
GACAACATGTAACCGCCATAACTGTAGTTGTGTTTTTCACTGAGTGATAACATTCTTCTT
ACTTGAAGGGTGCTCAGTGAGACCCAAGATGGGGTGCAGTTTTCTGGGACTGAAAGGATG
GATCGTAAATTGGATGTGTTTAATCTGGGCATCAAGGACCCATGGAAGCTTTGCATTCCG
GGTTATGGAACTAGATGGAACTCTATATTCTATATTAGGGGAGCAGGAACCTCATTCCTT
CCATTGCCTGCTATGAACCCCTTCAGTATTCCCCAGTATCTGCAGATTGTGAGGGACTGA
GCCAGCACCTCCAATGCCACCATTTCTTTACTTAAAGGAACCATTAAAGAGATCCTGGGG
ACTGCCCAGTCAGTGGGCTGTAATGTTGATGGCCGCCATCCTCATGACATCATCGATGAC
ATCAACAGTGGTGCTGTGGAATGCCCAGCCGTAAGTGACATTTTCATTGTTACAGTAGGG
GTGAAAGGGGGGCCACCCAGTGTATTCACAGAGATAAGCTGGGAAGTTTTGGAAATGGTT
ACTGGTGGGGTGGGATAATCCTTTTAAACTTTTTACTGATTTTTTTTTTCTTTCCCACAG
AGTTAAGCACAAAGGAAAACATTTCAATAAAGGATCATTTGACAACTGGTGGATTTTCTG
GTGTGGCGTCTTCCTTGAGGGAGCTAGCTCCTTTGTGGGGTGGTCAGTGGGGTCAGGGTG
GCAGAACCTGTGGAGAAGTAACAAGCACCTTGTGGTGGGTAACAAAACTGCCCTGTATGG
GCTGGGCTGAGCTCAGAAAGGAAGCCTTTCTTTCCTTTTTTTTTTTTTGAGACAGAGTTT
CGCTCGTTGCCCAGGCTGGAGTGCAATGGTGCAATCTCGGCTCACCACAACCTCTGCCTT
CTAGATTCAAGCAATTCTCCAGCCTCAGCCTCCTAAGTAGCTGGGATTACAGGCACGTGC
TAAAAGACAGGGTTTCTCCATGTTGGTCAGGTCAACTCCTGACCTCTTGATACGCCTGCC
TTTGGCCTCCCAAAGTGTTGGGATTATAGGCATGAGCCACCATGCCTGGCCAGGAAGCAC
TTTTTGTAGACTATCATGAAGCCTTTCCTAAGAAATGCTCTAACAAAACCGGAACACATG
GGGAGTGTAGCTCTCCATCCCCGACCAACTGAAGTTATGAGTGGGTTGGGGGCCCAGGAT
CCATTTTGCTAGCCATTCCAGTGCACAGCCAGGGCTCAGAACCACTGACCTGACCACTCT
CCGAGTCCTGGACTAATTCTTTGGTCCTGTGAAAGTGAGGTTCACATCATCTGTTGAAGT
AACTATAAACTGTTACTCCAACCTTTCCTCTGAACTCATGTGGCTTAAAGTATTTTCTGC
TGTCTCACGTTTCTCAAGTCTCATCTTCCCACAGTTCTGTTCCTTCTGATGAACTTTATA
GAGCCTGTGTTCATCACTCCCTTTTGTTTTGCGATGAACCCTAAAGCACTCCTGAGCAGC
TTGAAGCACCACCTGGGAGAGGATTCTGGGTACTGGAGTAAAGGGAGTTGGAAGTTGTAG
CCCAGAGAAATTGATTTCCCCTATATGACTCATTTCTTTGCACATTAGTTTTTGCCAGTG
TCTCTAGATCAGTGCTTTTATGTCACCTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1125, 1602..1675, 2698..2796, 3044..3125, 3983..4069, 4417..4529, 4680..4730
1089..1125, 1602..1675, 2698..2796, 3044..3125, 3983..4069, 4417..4529, 4680..4685
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved