Homo_sapiens Locus COX7
snOPY snoRNA Orthological Gene Database
Homo_sapiens COX7
Homo_sapiens
COX7
5
snoZ39
3540..3602
4798
TCTTCTCAATACCTTCTGGTCAAAGACCACCAGAAGCACACATGTAATTGACAAACGGG
GTTTATTATTCATTGCAGTAAGGGTTCTCTGTAAAATATTAGAAAATGCTTATTGGATTT
GGGATTTTTTTCTCCTAATATTGGCTACCTTACCAAATCTTAGGAGGAAGAAAGGCTAGA
TCAAGGCTAAGATTGTAATTGGTAAAGAAGCAGAAGTCATCAAATTAAACCAGATAGGGT
GATGTCCGGTCATTTTCGTGGCTTGGACAATGTTTTATCTGTGTTCAGATGTGATTACAC
AGTGATCATATTCTTTTCTTAATGAACACTGTCAGAGTGGTCTTGTTGGATGCTAATGCT
TGCTGAAATTGTGTACGTTCATCAGGCGGACACCAGTTCCTAGTCCAGGCTAGCTCCAGG
TGTCAGAGGCCACTTTTCCCTTCTACTCCTCACACATGCTGTACTCATACCAGACTTGAG
TTTTCCCTGCCCTTTGTTCTTCCTTCTTTTTTATTCGATTCCCATTATCTTTAGTGATCA
TTCCCTTAGCATTTCAGTTTTCTCTCTGAAGTCCTTTGTGCTGCACGTTGTTTGATTACT
TGTGTTTATGCTTTGTTTCTTCAGCTAGGATCATTAGCACATATCTCTCAGCATTGGCAA
AAGTCCTCGAAATCATTGACACCTAGCATATACTTTATTTTTAAAAAAGAAAGAAAGAAG
AGAAAAGGGATGGGTTTATTGTCCTTTTCAACAGACTAGAGTATACGGGGTGAAACTGCT
TCACTTGATTCAATAAAATCGTTTCCGGTAACAGGCCCCAGGAATCCTAGACCTAAGCCT
GGCGCGAAACTACATTTCCCACAATCCTTCGGGGGCTGATAAGGCTCCGCAATGGTCTGA
ACTACAATTCCCACAATCCAGGGCGATTTCCGCTTTGTCGCGTTTCCTCAAGGCTCCGCC
CCATTTCCCATCTTTCTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAG
GTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGCGCCTTTCGCAGAGCTTC
CAGCAGCGGTATGTTGGGCCAGAGCATCCGGAGGTTCACAACCTCTGTGGTCCGTAGGAG
CCACTATGAGGAGGGCCCTGGGAAGGTTAGTGTGTAAGGGGCACGGCTTCGTTGGGGGAG
GGGGCGCTTGGCTGTGACTCGCGCACCTGCAAGGCCGCCTCCGGGCTGTGGCGTGGGAGA
TGATAGCCAGAAACCAGGCTGAGACGCAGACTAGCATTCCACTTAGCCCAAGGACCAGTG
AGGAAGCTGGGCATCCTAGCGCGTAGCCGCTAAAGGAATGGGCAGGTAGATCCGGAAGCC
CTGCCTCCATCAGCCACCTGACGCCCCCTCCCCCGCCCCGCAGAAAGCCCTGAGATGGCT
CCGGGAGGCCACGGCTGTAGGTGTGTTGGTTAAATCCGAGCTGGAGGTCATCGGACCCGA
AATGAAGGTCATTGGAAAATCATGAGGAAATCAGGGCCTCTGGTTATGGAACAGGCTTTT
TAAACTAGCTGCCTAAGTTAGAAGTACTAACCCTTCACCTCAGTTAAGGCTGGGTTTGGC
CTCAGGTGTAAATAACTTAAACCACATAGCAGTAACAATCTCGGAGGGTCACACGAGGCC
TAGTCATAAAGGCCAGAGAAGGTGCTTGGTAATGAAAAACAAACAAACAAAAAAAACTGT
GGGCCAGGTGCGGTGGCGCACGCCTGTAATCGGGAGGCTAAGGCGTTCGGATCACCTGAG
GTCAGGAGTTCCAGACCAGCCTGGCCAACATGGCGAAACCCTGTCTCTACTAAAAAGTAC
AAAAAAATTAGCCGGACGTGGTGGTGTGTGCCTCTAATCCCAGCTACTCGGGAGGCTGAG
GCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCGGGCCACTG
CACTCCAGCCTGGACAGAGCGGGACTCCGTCTCAAAAAAAAAAAAAAAGAAAAAAAAAGA
GCTGTATTGCACTTAACATTGCCATGTATCTTCTAAGGTGACTACTTAGGACAGTAGTTT
TTTCGATTTTCTAAAGTAAGAAACTTCTCACTATTTGACGTTTGAGTCCTCAAGACCATT
CATTGCCTAGTGCTTAGTAAAGCCAGATTATTTCTTGCCATGTAGTGTTTTGTGATGAAG
GTCATAGGATTTGAAAGATAAATGTTTAAAACGATGTTATGATTTATGGCATATGTTAAC
CTGATGATGTAAAATATAACTAGCATTTCCTGTATACTTGTATTTTGATTATTAAGCAGA
TGATTTGAGATTCAATTTCGATTACTTTTTCTCTTTTTTTCCAACAGAATTTGCCATTTT
CAGTGGAAAACAAGTGGTCGTTACTAGCTAAGATGTGTTTGTACTTTGGATCTGCATTTG
CTACACCCTTCCTTGTAGTAAGACACCAACTGCTTAAAACATAAGGATGTTTCAGTTCCT
CCATTTAACAGGTAGTTAGTGGATTTCTAATCATGTTAAAGCAGGCCTTTTTATTAAGTA
GCCTCTTCCCCATCACCCAGAACACACACACAAATACATTGTTGTGTAGGGCTGATTCCT
GAGGTTATGTGTAGATGTGGCATTGGTGGAGACTAGTTGTAAACCTATATAAAAATATTT
CAATAATGGCCAGTGTTTATTGAATACTACTGCTTATCAGGTACACTTTACATCGATATC
TCATGTTCTCTAGCAAGCTTGTGAGGCGGATGATAGTAACCCCATCTGAGACACAGAGAT
GTTAAGTTGTTCAACATCTCATAACTAGTATAATGGTGGACCAGGACTCTTGCCCAGGCA
GTTTCTTGTTGCAGAACTCACACTTTTAACCAGGTAAAACTGATAAACTGATTAATGTTA
CTCTATCTTGAACACTGTTACTAGAACAGTAGCTGAGAATGTGTCTTTTAAAACACTATA
AACATTTCCATTTCTTTTAGAAAGTGGTCACTGTGCTCCTAGTTTTTAAATTGGCTTACA
ATACTTGTTTAAGTTGTGAAAAATCCCTGAAGATAAAACCCTTCTAGTGCTCCTTGATAC
ATAAGTCCCAGATAATTATGCAATTGTAAATCTGTGCCTCACCAACTCAGCCATGTTGGG
AAACTCAAACTTTTAAATATACTTTCCTCATTAAGGCAGTGGTTCTTAAATGAGGATGAT
TTTACAACACAATGGGGCATTTGGCAATGTGAGACATTTTTGATCGTTCCAACTTGGGGG
CAAAATTACCAGTGGTGCTGAGGTTGAGAAGCCTTGTGTCAAGGGGATATGTTAATATAT
GCTCAAAGGAGTCGTTCATATTGGAAGGTTAGCAGATTTGCTGTGTGTGGATAAAATATT
TAGCTTAATTGTCATCAGAGTTTCTCAGAGTAATACTATAGAACACTAGGATGATTGGAA
AGAGTGTCATAGTTTAGAGGGGGAATAACTTATCCAAGCTACTAATGCGGAAAGGTTGCG
GTGCATGTGATGAAGCAAATCAGTATGAATGAATTCATGATACTGTAAACGCTTTCTGAT
GTACTACTCAAACTGATAGAAAATATTTTCATGAAACTACATGATTTCTGTTAAATGAAT
GGGATTTTTAAAATGCCATTAATTTCTGTTTTTATTTTGCAGATATGAAGAGCATTTTAA
GAGGTGCAGCCTCTGGAAGTGGATCAAACTAGAACTCATATGCCATACTAGATATGTTTG
TCAATAAACTTATGACGTGAATGCTTAATGCCTCTTTTTTGAAATAGGGAATGTAATAAT
TGGCCATTTGCCTACTTTATTATTTGGGTAACATTCCAGTATTACTCTCTGTGATTTAGC
TTATTTAATGGTGTTAAACTGAGGTTATATTAAATTTTTGATTCCCAGGTCAGGATTTTG
TTGGTAATTTATATAATAAAAGGGAAATACAAATCGATCTTAGGTTTATTTCTATGATTT
TTTTTTTTATCGTTAACTTGGAAAAAATACTTTTGCTCTTGCCCTTTGACATAGTAAATT
TTTTTTCCCATGATTGATTAATCATCAAGAAAACTTAATTTATTCAAATTGAAGTTGTGG
TTAATCAGATATTTAGGAGCTTCATTTTTGTTTTTTTTCCTCTAGGTCTGTAACCTAAAA
CAGAAGTGTTTGCCTCAGTAAGTGTTTTGGTGACCAGTATTGGTCTTATTTAGAATGAAT
AAAAGAATATTTGAAATTGAATATAATACCATGAAATTTGTAGTATAGGAAGTACTCCCA
ATTTATTCTGGTGCTTTGACTATCATATAGCCTAGCAGAAATGGGATAAAAGGTAGTTCT
GATTAGTAATTGTATATGTGAATCGAATTTATTTTGTAAGTAGTGAAATGCTGCTTGCCA
TTTAAAATGTAATGAGGTCATTACATTTTAGGACTTTGTGTAAGATGTGGGACAGTAACT
AGCTACTGAGTATTTTCCTCTGCTCACTGTTGGAATACCAGTGATGTTAAAATGCTGTAA
AACACTCCAAACTGGTAGTCTGTTTGGCCTCTAGACTTTGGTGAAAGGGTGATGCTCTTT
TTAAATCAACATTTAAAAAACAGTATTTCCATAAAAGTGTATTTCTGGATTTTTGAAAAA
TTGTTCTGAGTGGTTCTATATCTCTTCATTGAAGAAAATAGCTGTGTAGGCCACTCCCCA
CTATATCATTAGATTTCTTATATGGCCCTTCTGTACAACTACTGATTTGCTAAAAACTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1164, 2387..2530, 3702..3798
1090..1164, 2387..2500
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved