Homo_sapiens Locus RPL37
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPL37
Homo_sapiens
RPL37
5
SNORD72
3478..3557
4758
ttttgagacagagtctcactccgtcatccaagctggagtgcaatggcgcaatctcggct
cactgcaacctccaccttccgggttcaagcctccctccacctccaccccctgagtagctg
ggttggcaggcgcgcgccaccacgcctggataattttttgtattttttttgtagcgacag
tgtctccctatgttgcccaggctggtctccaacgcctgggctcaagagatccgcccgcct
cagcctcccaaagtgctgggattacaggcgtaagccacggcgccaggcccttggaaacta
tattgaacaagttccatgtgtgattccttggcacaatgaaatatgggatcagataacttg
cctctgatttactacagtaacaacaacaacaaaatcactgtctgcttttccctttatatt
ctaagctccagctccatgcctccgtactcctagcgacctctcgcagggaaagtcagcgtc
ggccaaaagcctccgggatcggaatgaggaggctgctggagaagttgctttctcctaaaa
gggattatcccaggcgcacacggtcattacacgccggggacgctcagtcggtgcgggtac
ccctgggcagggccagccccgcattccaggttctccatgtgcctagaagacagtaatcga
cggtatagcaacagatctgactgctaacgtgcgaaaccgatcagtagtagcagtagcacc
agcaacagcagcacgaaaagcaaaactgtaatctaaacggccctcagggtctaagcaggc
ccgacgaagactcgcccatccggtcgccagaaaactgggagtcccgcccgcctttccggc
actgaaacgcgatcggccctgcctggtaccgcatcctcctcttgaccccacctacactac
gacgacggacgctcgagaacgctgcaccgcgccccgcaggaagtgcttccctgggcggaa
gcttctgagcgtgatatagcggaagtgccttctcttccggtCTTTCTGGTCTCGGCCGCA
GAAGCGAGATGgtgagttgtgactgtggtgtttgtgaatcgcgttccatcctcgtccttt
gtgcctctctgtttgctgtgcttggggggctggcaagattccggataaggggaactggtg
ggctggaaagaggcatgcggtggccctcaagagccagaagaatgactgctaactggtgcc
tgggggacctatcccgccgtaattgtggtgctagagccgcattgtgtcctttgcctcggt
ccaacctttggagacctttcacggctctagccttggttgggagccgagggaaggagtttg
ggaatgtttggctctgtgtaacaatgaaataattcattggtgatgctctctggccggagt
ctgtaaagataaggtgcatttcagaacattgcaactcttgcggagggttttaggtaacgt
gaaatgcgggtagtggtctctgacttggcattcgtggaaagaggcttctcccgcagtttc
gatctttacgattgcctttaaattttatcagtaattggtttcccggagaactcgagtaaa
tctagaagttgccaggtttcagaactatttattcctttaatgtgcagACGAAGGGAACGT
CATCGTTTGGAAAGCGTCGCAATAAGACGCACACGTTGTGCCGCCGCTGTGGCTCTAAGG
CCTACCACCTTCAGAAGTCGACCTGTGGCAAATGTGGCTACCCTGCCAAGCGCAAGAGAA
AGTgtaagtaacatttttcaggccaactgtgttagcttttgtttgtattgcacttaagtg
ggggcataggtttgaactttatttggtgcctatcttaaaactcgtacatctgtatgccga
tgaggtggcataaaactcgtgtgttaacaacacctacaaggtgtgtgggagaacaccgtt
tgaaatcttttctgaacttatgttttagATAACTGGAGTGCCAAGGCTAAAAGACGAAAT
ACCACCGGAACTGGTCGAATGAGGCACCTAAAAATTGTATACCGCAGATTCAGgtacagt
ttgtatgttcgatcataattggtccagtgggcttgaatgaaaccctcgtgtttacttgta
aaaagataacagtaccctgatggttactggggatgagatgttggaagctttttatttatt
gttgtttttgaggcagggtttcactatgttgcccaggcttgagtgtagtggcacgatcac
ggctcagtgcagcctcagtctccccagcctcaggtaatctcatctcagccgcccgagtac
ccgggactacaggtgtgcgctgccacatgcccagctaatttttgtatttattgtagagaa
tgggatattgtcatgttacccaggataatctcggaactcctgggctcaggccagatgttg
aaagcttttatcttctgccgctgtaaccttgacatcagttagtttggattttattagtag
ttttttcactaaacagtagtataaattaaataacaggagcattgtttgaactagggtccc
aaagtgttgatatttattaggtttaattggtgtcaaaatttgtcaagacagtagtgaata
aggtctggagtcaggcttggttcaacctttagtatagtggctgtgggcaagagtgctgta
gaaaattgccctggttgctgctgttgccttgggctcttgttactcaagtcttggccttag
agttataaatgcagaatctcagctccgccgtagacttagctgagagaacctgcatattaa
agagtagtttctaagagattaacccatctaagatctcagctaagattcagaatgatgcag
acttaactataaagctggtgctccttccgttactatgttctatttcagcaattctcagct
attgatactttgggctggataattctttgtggtgggattgtccagtgcaaaattgaatat
tttgcagaatccctagcctctacccactcagtctccggagtgtccagttttaaagatagc
aagacagttcagggctttgtagacacccataggtgtgttcatgtgctgaagcaactttct
ttgcatttagggtcataacgtttttgtgggcttaatgttgagtggtctgttagtacaata
taggagttaagagcttgaactgaagccaggcttttaaaagtaggatagttgacctttctt
agagtagatacttcttagagtagatacagatgttaaataagttaaaatgcaaagctcttg
gtttagaaaatgtctgccattaaacatgctaattgttttttccttgcttagtgaaagtag
ttgggatctattctcagtatagggaaccattttcacaaataatctgtgatctcttgccaa
atatgaacaaacatactggcccaatgactagtatagccaaataagtttttgagcctttat
tgcagttgcagttaactatatccgaaaatgggtatctttaagcaaagtgaagaatttcag
cttatcagtgatgttgtaaaaataaatgtctgaacatatgaatgcagtattgatttcagc
atttaactgagataagcgcattgaaatctgtttaacaaaaattaaaatgtatgcatcgat
gttgctgaagtaacttgttcttgtttttgacatcctgcagGCATGGATTCCGTGAAGGAA
CAACACCTAAACCCAAGAGGGCAGCTGTTGCAGCATCCAGTTCATCTTAAGAATGTCAAC
GATTAGTCATGCAATAAATGTTCTGGTTTTAAAAAATACatatctggttttggtaaggta
tttttaatcaattaggcttgtagtatcagtgaaatactgtaggtttagggactgggctag
cttcatatcagatttacttgttaagtgactgttttggaatgtttacttttggactgggtt
tgtaacacggttaaaggcaatgagaaacaagcagaattccaggagtccttgaagcagagg
gcactggaagacaatatagcagattaaaatagcacagctcatgtggcataggtgggtatt
ttagatgtttgagtaaatttgaaagagtatgatgtttaaattacctttagcaacatgttc
atctgctatgctgtcatgactagggggatgattattagtcacatagagcttgggagtacc
actggaaacgtatgggtaggagtttaggtggcttctgtttttcaaaagatgatcttatcc
tagtatctgtaatgctcacttggcacacctgacttgtgggctgtgtgtaaggtggctagc
taagtgaaaaaagcctgctaggtgtgagtcaacttaagaatatgtaaataggtttgagaa
aaagtagggcttgggtgcaagtaaagattgagcaggaaataaaggaaaatcaagtataat
ccctgagatttgtagactaaaggcaatgatgtgggactacttggtcgaatttttttagcc
ctcaacttggtaattgggtgtttctgtgttaaagcactgaaacttgctgtcgtgccttcc
tagttttcgtggtttattgacagggttgggggttttttttgtttttttaaaatgaaggga
caaagtcaactggactgctgagtgagagggcaggggcagttgaagggaacatgaattgct
ggaacagctacataaaatagtgatgtagccaagtcatgctatttaaattataattctcca
ctgtgtttagaataacatctgaggttcttaacctggccttggaagggtatcacttttact
tgtaacctggaatggcttt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 1607..1742, 1948..2032, 3640..3758
1028..1030, 1607..1742, 1948..2032, 3640..3709
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved