Homo_sapiens Locus RPS12
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPS12
Homo_sapiens
RPS12
6
SNORD101, SNORD100, SNORA33
1740..1812, 3235..3310, 3652..3784
4996
caggcacattgtaggtgttgaaaatgcacctgaggaattctgagttgcgcggaactgtg
tattccgagcacaacgcgtcgttaaaaaccaaacaaagcagaacaaacttcgttcagaag
cgactcccgctatacttagaaactagaattgacccctggctgcagggttccgctttacca
acacaccgcagggaaagggcttagaaatagtgaaagcggccgggggcggcgggtcacgcc
tctaatcccagcattttgggaggccgaggcgggtggatcccctgaggtcaggagttcgag
accagcctggccaacatggtgaaatcccgtctttactaaaaatacaaaaaattagccagg
gtggtggcaggcgcctgcaatcccggctactcgggaggctgaggcaggagaatcgcttga
aaccgggagccggaggtcgcagtaagctgagatcgcgccattgcactccagcctggaaga
gtgaaagcatgtaggctctcgtttcatgaagacaaagatgaggatcacacccacaacgac
acaaacatggtctctcagggtgacttagaagcgaaggaacaaagtgcgctgcctggggag
gctgggtcttgtagaagcaacaggaaagtagaacgtggtgtggaaagggttaaaactggc
gctcggcgggatacagggctctaggtgccttaaagaacacgcggacacacttgtttggct
tctgtcgcgctccgtagaatgagttccctgggcctcggtgggccacgcctccgcaaagaa
ggacaacgcgaagctgcccgcgtagtgcctgttgcactcgccaaggaccggcctggcaga
gatagaaaactcgcagtacgtttgcctcagaaccgcctcaatccggaaacagaaactccc
caggcccggcactgcgggagccacctctttcgagggtgggagtgcacatgcgcacagggg
acctgaaaaacccttaaataccggcatgcgtgcggatgaggCCTCTTTCCCTGCCGCCGC
CGAGTCGCGCGGAGGCGGAGGCTTGGGgtaagttgagcgaggcggcaggggggtgtattg
gttataatttgtggctcgttgcgttcttgctgggattcgtgacgagtatctggttcttta
acaagtcaatgcttttgttttttagTGCGTTCAAGATTCAACTTCACCCGTAACCCACCG
CCATGGCCGAGGAAGGgtgagcccaggggccggggttggagttggggtcggggtgcggct
gaggcgtggggctagagctggcggaacaggactgggtcaaacgggtcgccgtaagcgcgt
ctgttgtacacttagcttttgctgagtgcaaggccttatgtggtgtgaggattttaactg
atggttctgatgtgtcgcgtttaagCATTGCTGCTGGAGGTGTAATGGACGTTAATACTG
CTTTACAAGAGGTTCTGAAGACTGCCCTCATCCACGATGGCCTAGCACGTGGAATTCGCG
AAGCTGCCAAAGCCTTAGACAAgtacgtgtatcagtctcaatactgtgggttcttgcaac
cggaacaaaactgccacccaagggaagaaggcatggagttcatggtgttagcgcaaaagt
tctgaatggcatccgtcctaccggaaacctaggaaaaggtatcagaactcagatctataa
agcccacttaaaatgtgtgggttgctgtttggaatggggataagcactcaaaactacagt
gtttgaatgatgactttaattgtcggataccccttcactccttttatgagtgaaacataa
gagtctgacaaacctgtaggttgtggagctagtcagtcttatacttatctggcagataga
tgagatggagagccacattacatctggtagtttgcaaaacaagcattaatttaatggaat
ttcaaactcaggtttcagaagcatttggtcctagatgaatttagtagtataatagctgtg
atttatttgaatttgggatatttgttaatgtatttgaatggatcgagttaatgtgttttt
tagggtggtggcattgacaaatcaacctactcttgagctgaatttaaatgcagttttaag
gttttacaggacaagttcgttttggtgtaatctagccagttcaatccgatggaaacggca
ttattgtttaatgtatttagtaggtcctagtatgagtcttctgtatttctatttcggcat
tattgcatggcatttcataactgttccattaatgccacagtcttttttttttcttttttc
ttttttttttttgagacaaagagtcttgctctgtcccccaggctggagtgcagtggcgcg
atctcattgcaacctctacctaccaggttcaagcgattcttctgcctcccgagtagatgg
aattacaggcacacgccaccatgcccagctagtttttgtactttcagtagaaacggggtt
tcgccatgttggtctctggctggtctggtactcctgacctcgggtcatctgcccccctcg
tcttcccaaagtgctgggattacaggagtgagccatcgtgcccggcctttcacatgtttc
tttaggtatatgaagctggcttacaagaaagctattatggttgggttttggccagaagtt
ttaaaaatgacttacaccaattcagtgtgtcagggacagaggttttactgaagaccagtt
gtaggttaattgaagatgtatatgctccctagcaggttcttcagactcaagcaattttgt
acgcatttatgtgttcagtggattggctgcttatgtttcgcaagtgttagtgcaaagata
accctcctaaaatgcaagaatgatggatttggatctgagttttagctccattttcattgt
aatttgaatttcagGCGCCAAGCCCATCTTTGTGTGCTTGCATCCAACTGTGATGAGCCT
ATGTATGTCAAGTTGGTGGAGGCCCTTTGTGCTGAACACCAAATCAACCTAATTAAGgta
aggctgctaaggattgtgttgggactaatgttcagtgatgcttgtatatgggggtaaatt
ctgtgaagtctcaagctgttcattttgtgcaggtgtaaacattacgtgcacctgatactg
tcggccattttaaagatgattgtaggtagaagcattttatacctgcagaattgaatccta
attttgacgttggtatacaacaaagattagtagcaggcttgtaggtgatcttagtgctgt
acatgatgacaactggctccctctactgaactgccatgaggaaactgccatgtcaccctt
ctgattacagccaccttttgggtttcatttaattttggtagtgttaatgtctattaatgt
gattttttttttttttaacctttctcccaatagGTTGATGACAACAAGAAACTAGGAGAA
TGGGTAGGCCTTTGTAAAATTGACAGAGAGGGGAAACCCCGTAAAGTGGTTGGTTGCAGT
TGTGTAGTAGTTAAGgtaagtcaccgtttattctagggatgaaggttatgctgggtaatc
atataaaaccttgtattgaaataagttgaggatcttataaaaggaaaaaactgattcaac
aggtttaaagcattttctgcatttcaggaaaaaaataaaagctgtaatttacaagccagc
caatgaatctgcttacctgattgtgtttgtgcagacatactttaaaaactggcaatagta
aagccatgttacgagccttaaggacattgaagtcgttaaggtccctgagaatggctataa
caaatcttagtgatgggaaacatttttataagacatagctaattgttgaagctccactat
aattgatactaatagcttggtgaaattcctaaatattaacaagaaattgcatgcgtgttt
tgttttttttaagGACTATGGCAAGGAGTCTCAGGCCAAGGATGTCATTGAAGAGTATTT
CAAATGCAAGAAATGAAGAAATAAATCTTTGGCTCACattcctcatgtctggctttttat
ttggggcagtaaaataaggtccctgttagcaaagtaaaatgtaatcatcgcaaagtgatt
gctacagattaactggaaacttgctctcaaagtcttctccccagccaatgactgcatcat
ggggcaattcaaacctggacagccttagcaaagataggtctgccatgcagtgttggtgat
ggccaggattacttagctatgggcatttatccctcactagactagcctagaatttggaga
gagaggttgtgtttttaatagattgcagtctatgaaaggacagtgagtagacttgctggg
caggttagtagaaagtacacagttgggccaggatcatatcttgcatgtgggacaagtgtt
atgatacccaggaatgcttgtggacattcgtttgacttctttggttggagacggagtttc
actcttgttgcccaggctggagtgcaatggcgcaatcttggctcactgcaacctctttgt
cctgggttcgagcgattctcgtgcctcagcctcccaagcagctaggattacagatgcctg
gcaatttttttgtgtttttagtagagatggggtttcaccatatttggccaggatggtcta
gaacttagacagcaggtgatccaccagcttcagccttccaaagtgctgggattacaagtg
tgagccaccattcctggccttttgtgcaggagcgagaggggcttgaatgcaccccagtcc
ctagaaatcgcagtgagagaagccatggctggtgtttggtgtattttaaacttggataaa
ggtaccgttaaaagaatgttgtgaggccatatacttggccaatcctggttttgaagacta
taccaaggtttttctttgcgtcttaaaccttgattgagaatctccgagtagggtctcccg
tactggttggtttggtagttatagctaaagctggttgaccttagcatggtagtgacattg
agtaccctcatggaaag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1046, 1165..1215, 1405..1521, 2894..2996, 3393..3494, 3913..3996
1202..1215, 1405..1521, 2894..2996, 3393..3494, 3913..3975
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved