Homo_sapiens Locus small nucleolar RNA host gene 5
snOPY snoRNA Orthological Gene Database
Homo_sapiens small nucleolar RNA host gene 5
Homo_sapiens
small nucleolar RNA host gene 5
6
SNORD50B, SNORD50A
2063..2132, 2353..2427
3637
ACTGAAATGTTCAAATGTCGTGTGCACACACACACACGCAGACATATTCACTCGAACAT
GCTAATTAATCAAAGCACTGCTTTTGAATTTTGTGTTTGTCGTCTGGATAAAGTATTCAG
GGATACTTCTCAAATTAATCTTTCTCTCGTTTTCAATATAACTAATTGAGTACAAAGAAG
TTAAAAATTAGCAAAGCATTTCAGCTGTGTGACCTTAGGCAAATTACCTGGCTGTTTTAA
GCCTCAGTTTTCTCCTCTGCGAAATGGAGTATTGAACCTCACGTTCGCTGTTTGAGGGAG
ACTTGTATGGTCACGTTTAGTGTAACCGGATGCCTGGCACGAGGAAGCGTGAGGAGGAAT
GGATCCCCATGGGGCCTTGATGCCCGCCCTGAGGCCCTGCAGGGCCGCACGCCGGGGCTG
TTCTCACGTGGCGCTTTCCGCTTTTTCACCCAAGCGTTTCTGCCAGCCAACTGCCCTTTC
CCGGAGTGCTGCGGCCAGGGCTCGCCCGCTCCTCCGGCGGCCTCCGCTGGGGGCCCACTA
CAGCCCAGCGCCAGCCAGCCAGCCAGCCCAGCTTCTCGAATCGGTCCTAAGCTGAGGCCG
CCCTGCGCTGCAAAACTTGTGTCCACTCTCGGACCCAATCTGTCCTGGACGGACTTGGCT
CGTGGCAGGCGAAAGCGTCGTTTCCAACTGCAGCTGTTTGAATTCTGGCGCCACACCCGC
GCCACGTAGGGCCAAGTCGGCCGCCAGACTCGTAAGAGACGCTTCGCAGTGCGCCTGCGG
GCGCGCGCCGGGAAATGGCCGGGCGCGCGGCCGGCCTGCGGCGCGCTCCACAACGCGGAA
CGGGCCTCAGAAGAGCCACCGCGCGCGCTCCCGCTAATTCGCGACCACACCCCTGTCTAC
TTCCATGTCCAATAGGTGCGAGAGGGCGGGACGGCCTCGTTCTGACTCCGGGAGGCTATA
TAAGGAGCTACTGGCTGCGCACTTCGGTCTTTTACGTCGGCCTTCGCGAGCGTCTGGGCG
GGTGGTAGGTGAGTGGGTATTGCGGGCTAGTATCCGAGCAAAAGATGGTGGCGCAGGCCG
AGTTAAGAGCTTTAATCCTGTGAAGACATCTTAGTGAAGAGTTTAGAGTGCTGAGAGTTG
AAAGCTTGCACGTGGGAAACGTGCGGCCGGACTGCCACATGTACTGAGGTTGAGTCGTGA
CGGCCACAGGCTCCGAGTTTTGGCGTGAGGAACCGCTGATCGGCCACGGGCGCCGAACTT
GCTGGCCTCCGGCATGTGCCTGAGCGGCGGCGGAAAAACCACCTTAATTGGGGCGGAGGG
TTAGTTTTAACAGCAAAGGGCCTTTACTAAAATGGCGAAGGCCTTCCGTCGGCGTTGTTT
TAAAATGGGAAGCCTCGACCCTGTATTGAAACTGAGCTGTTCGAAGGCGGCGTTGTGTGC
AATTCGGATTAATGAAGGGGAAGGGTTTTGTGTGGAAAAACGCCTTGGAGTGTGACATTT
CTGCGAGAATGCTTAAATACCGATTTCCCGCAGGAACAATGGCGCTGTCTTCAGTGGCAC
AGTGGAGCAGCTCTGAAGATGCAAAGGTAAGAGCTTAGTTAAGCTTAGTTTCCAAACTAA
AGGAGTAAACCTGTTGATTTACAGGAATAGGAACTGTTGCATCGTTTGAAATTTACTTTT
TTTTGTTAGATACACGAAAAAACTTCCAGAACATCTGGGAGAATATTTAATGGAAAATCG
CTTGGTTAAAACCTGACACTTTTAACAGGTATGTGTTGTTTTAGTACTTTATGATTGAGC
ATAGCATTTAATCCACACCTAGACTAAATCAAATTTTTTTTGTCAGTGAACAGCGTTCTG
AGTGTGGACGAGTAGCCAGTGAAGATAATGAATGTCGAATGTGACTGACTAGCAGCTTCA
TTTTGAAGTAGGTTGTATGGCTTAAAAGTTCTGTAGTATTTGTACTATAATACTTGCCTT
TTAGCATTACCTTGGTTTGTAGTCAGTGTCACAGAAGTGCAGTTTAATGTATTATGTGTA
CATATACAAGGTCTGATTGGTCTAATCAATGATGAAACCTATCCCGAAGCTGATAACCTG
AAGAAAAATAAGTACGGATTCGGCTTCTGAGATTAAGACCAGTAATTCAGAGGTGGAGTA
AATTTTGTTGCCGTGATTTTATAACAGTTGTGTTATAAAATCCTGGGTTTTTTTTTTTTC
TGCCAACAGTGAGGGTCGCTGTCTGCCCATTGATAGAGGCCAGATTGTCTTGGAAGTTCC
AAAGTTGCAACGATTTCTGTAAGTGGAGTTTTTCTGTTTGCTTAGAGATCAGTGAATATT
GTGTCCTTGGTCTTATCTGTGATGATCTTATCCCGAACCTGAACTTCTGTTGAAAAAAAA
AAACTTTTACGGATCTGGCTTCTGAGATGGACCGTTATAAGGACAATATTTTTTTTTAAT
ACTTTTAATGCTTTTACATATGTTGTAATGTTTGTAGTCTTGTAAGAATCTCGTGTTTTT
CCTTTTCTAGGGCTAGTGCCACGAGGTTTACTTGACTGTTGTGTGAAAAGCTGATAAGAA
AACCATCCAGAAAAAAGCTCTTCGTTTTACAAACATGAAAATAAAACATGTAATTTTGGA
TTATGTTCCTTTTTGTTATTACTTTTAAATAGGTCCTGAAATAACATGGGGAGCATTAAA
TGGAAAATCCACTAACCAGCCTTGTAATCAAATTACTGTGAGTGAATGTTTCGGGTTTGT
GCAGGGTACAATGTAAGGGTTTTTGGATCAGTGTAAGAGTGGAGAGACAGGAATTAGAAG
TAATTGTTACTAAGCAAATCATGGAATATTTAGTTTTGATGTAACTATAATTTTGAAAGC
CTGGATGCTTAAGTTGAGAAATGGGGGAATGAGATACAGAAAATAAGGAGCACAATAGAA
TAATAATAGCAGTTTATTAAGTATGGTCATGAGGGAAGGTTACTGATAAAACAATCTGGT
AAAGACATTCAGGCTTGCTAAAATCTAGGAAGAGGTCATTTGGCAGGATGGGTTACATAA
TGCTATCTGATACTACCAAATAAAATGAGAGAGAAGCCTTAGGCATGTAACGTTTGGAGA
TAGAAAATGTACCTTCACTATGAAGGTAGTGTGTGTAAGATGGCAGTTGAAAGCATTGCT
TGTGTTTATGTTTATACCCTTGATCTCTGATGCCCTTACCTACCGTACTTAAAACTCTGT
TAATCATTGTCTTTCTCCCCCTCCCACAACTTCTGCATAAAATTTTAAGATCTGTGTTTC
ATTAGTTCAAGAGTGCCTAGAATAGGGCCAGGCACTGTTATACAGTATGTGGTAAAAGAC
TATTGAGATTCCAGTTTTCAAGGAAGAGTGCCATTACCGTTTTGTTAAAGCTGGCAAACA
AGACAAAGTTGTGAAATAGACTGGTTGCTTTGGAGCCCTCTGACCGCTTTTCCTGTAGCT
CCTTCTACCTCCCTTGCCTCCCAATAGATTTTTTAATATGTCACATTATCTATCGAAATT
AGTACTCCACATTTATATGCACTGGCTTGTGCTAGGCTCTGCCAAGACTCCTGAAATAAA
ACCGTTTTGTCAACAGTGGCACAAGATGCCAAGGAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1585, 1689..1767, 1846..1926, 2229..2297, 2530..2637
1508..1585, 1689..1745
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved