Homo_sapiens Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Homo_sapiens EEF1B2
Homo_sapiens
EEF1B2
2
SNORD51, SNORA41
3287..3361, 3635..3766
5334
GCCTTAAGTCGGTGAAAACAAGAATATTCCGCAAAACAAAAATAACTTGTTTATTCATC
AAAAACAGTTAACGTTACACTTCTATACCGTCAATTCGTGTGTGAACAGAGTTGTGTCTG
ATCCAAGACCTTACAGTTCAAGCACTGGATCCCAATAACCTGTAAACAACGTTTTGTTAT
TTGCAATGCAATCCTGGGCTAACTTTTCAAAAGTCGTTTTTCTCAATTTCCCGTTAGTTA
AAGGAATAAAAAAATGCTGTCCAACGTGGTCAATGGACCAAACAAACAAGGACAACAAAC
AGAAGCGTGAGCCATTGCTAACACAACAGCGACCAAACAATCATGCACTGTATCAGGCGT
GTAAAAATCTGGGGGGAAAGGCTTAGTCTTAAGGCCTAAGTCATCGGACACTGGTCCTCT
CCCGGGGAATAAAACGGCCTCCTCCTCTGAGAGGGAAATGTCCTGAATTTTCCCTGCAGA
GGGAAGGTCACCTGCAAGCCTACATTCGTGACAGCGTTCCCGAGGACCCCCTGATCCTCA
TCTTCTTTTCTGCTTCATCAGACCAGAGACCGTGGCTAAAAGCCCCCCATCTGCCGGCTC
TCAGGGGCTTCCGAGGCGGCGGGGCGGGAGGCGGCGCCCAGTCAAGGACAACAGAAGACT
ACGTCGCGTGGGCCAAAGGAAACAGTCCCGTCAATAAATAAGCCTCTGGCCGACGCACCT
CACCCTTCCCATCCATACAAGACCTCACCTTCTCCCCGGAGCCGCGGAGGCTGTTCTGCT
AAACTGTCTGGACCACGACGACCCCCTAGGAGGCCGGGTCGCTTATTCAATATGGCGGCC
TCGGCTAACTCTGTCAGCCGGGCCTGGAGAACGGAAAGCCCGGAGGGACTAGAATCCTTG
CATTCGACAAGTTTGTCGGCAATTTCCGTCAGCCGACCAGAGGGCGGAGCTGAGGTCGGC
CCAGCCCGGAGGCGGGAAGGACAACTTGGACCCGCAGTTCCGCCGGAAGTGGCCCCAGCC
TCGAGGCCGGGCGTCTTCGGTCATCTCCGGCGCTTCTAGGGCTGGTTCCCGTCATCTTCG
GGAGCCGTGGAGGTACGAACTTAAGACATGCCTATTTTATTAATTTACTTCCAAACGCAA
CGAAAGGTCCATGGACAATTTGTGGGCCATTTAATTCAGGGCCCCCAATTCGTACGTGGA
GAAGTGGGAATGCAAAAGTACTTTGACCTTTAACCTTCGGTCCGGCGCGGTGGAGGGAAA
CGCCTCCGTCTCTATATAAGGAATTTTCCGGTCTCTTCGGGTCCTTTTTCCTCTCTTCAG
CGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTCCCCAGCTCTCGGATACAGC
CGACACCATGGGTTTCGGAGACCTGAAAAGCCCTGCCGGCCTCCAGGTGCTCAACGATTA
CCTGGCGGACAAGAGCTACATCGAGGGGTGAGCGGACGGGCTGAGTCGGGGTGGCGGGGA
GGTTTCTCCGCCCGGGGCCGGGGCCACGTGGCGCAGCGTGTCGGCTGCCGCGGGAGGGAG
GGAGGCCGGGCCCGGGGCCCTTTCGAGAGGGAGGGGAAAGCGCCCCGTTGCCGTCTCCCA
AGGCCCTCGTGTGGGGCGAGCCCGGCCTCCGGGGAGCGGTTCACGAGCAAGGAAAGGTTA
AAATGTGCTTTATTTACACTTAATTCAGCCAGGTGTTTCCGCATCGCTGCCCAGTTAATA
CATGTTAAGCTGTAGATAGAGCAACGCCAGACATTGCAGTATTTGAGGTCTACTTAGTGG
CAGACATTTCTCAGGATAGCGCGGTGACCCAAACATATGGTTTGATTTGAAGGAGCTAAT
AAGAAAAGAAAAGCATTAAAGCAACCCTGCTGGGGTTAGTGCCCACTAATTAATGTGATG
CATACGGTATTTATTATTTATTCGCTGGCGTTTGTTTTTCAAAGGTGTGTGTGAATGTTT
CTGTGTCCTTGGCAGGTATGTGCCATCACAAGCAGATGTGGCAGTATTTGAAGCCGTGTC
CAGCCCACCGCCTGCCGACTTGTGTCATGCCCTACGTTGGTATAATCACATCAAGTCTTA
CGAAAAGGAAAAGGCCAGGTAAAATCATCTTTGTATAGAGCTGAAGAATAAGACTGCTCT
CGAAGTTTATCAGGATGTTCACATGACAAAACTGGACCCAGGCTACTTTAGTTTTGTTGG
GATATTGTAAGCTAAATTTTTCTGTAACCTTAGAAGGCCAAGAGACTGAAGCCCTCCATT
TTTTCACAGAACAGGTAGAACATGGACAGCAGCAATTCAACTTTTCCCCACACTGCCCTG
CCAATGTGCCTCGACCTTGACCTGGGGGGCCCACCTCTGGGGTGAGAGGGTGGCTCATTC
ATTCAGTCCTTGGCCATTCTTCTGAAACTGCCAACAAGGGTGGAAGTTTGGGGAAGTGGA
CTCCAGTTCACTAAGAATGGAACTGAGCATACTTAATGAAATCTCAAACAGAAATGTTCA
TACTGAAAGAGTAAATCATAGTGAGTATTGAAAATAATGTCTCACATGGTACTAATGCTT
GTCGGGTGAGGAGTTGAACATATGACAGTGTTTACCTGGGCGCATGTGAAAGGGTAAATT
ATGATTGCAAAAGGGATCTAGTGATAAGTAGTGATTAAAACAAGTTATTTTGTATTTTCT
GGAAAAGGATGTTATACTAGCTCAATAGTGGTTGAATTTAAATGTTTTTCAAGCCTGCCA
GGAGTGAAGAAAGCTTTGGGCAAATATGGTCCTGCCGATGTGGAAGACACTACAGGAAGT
GGAGCTACAGATAGTAAAGATGATGATGACATTGACCTCTTTGGATCTGATGATGAGGAG
GTATGGCGTCTTCTATAAAGAACATATCGGCCAGGCGCAGTGGCTCATGCCTGTAATCCC
AGCATGTTGGGAGGCTGAGGCGGGTGGATCACGAGGTCAGGAGTTGAAGACCAGCCTGGC
CAAGATGGTGAAACCCTGTCTGTACTAAAAATACAAAAAAATGTGGCAGGCATCTGTAAT
CCCAGCTACTCAGGCGGCTAAGGCAGAGAATTGCTTGAACCTAGGAAGCGGAGGTTGCAG
TGAGCCAAGATCGTGCCACTGCATCCAGCCTGGGCGACAGAGCGAGACTCCGTCCCAAAA
AAAAAAAAAAAGAATACATCGATCAGCAATTGTATCAATGTGGTTAAGCCAAATTGCCTG
GATTTGAATCCTGGCTTTAATTTATATGCCTTTTTCAAATTCTGACTGGTTGCATGATGA
ATAAAATCAAATCACCATCTTTCGGCTGAGTTCGTGATGGATTTGCTTTTTTCTGATTAA
GCCAGTCTTTTTTGTGATGACCCCACTAGCTTTAAGCAGAGGAACAACCAGCTTTCTGAA
GTGGATTAATTTTTTTTCTTTACAGGAAAGTGAAGAAGCAAAGAGGCTAAGGGAAGAACG
TCTTGCACAATATGAATCAAAGAAAGCCAAAAGTAGGTCATTTGTTTTTAACTTCATTTC
ATGTTAATGTAAGTAATCTTTTTCAAAGCTTGACCTTGAAGTAATTTCCTCCACATTCCT
TGAATAGGTCAATATTTTAAAACCTGTACAGGTTCTTCCACAGCTACTGGTCTGCAGCTG
TTCTTATGGTAGCAGTTGTGGCATTCCTCTGTGGGAAAGAAACTGTTAACACAAACACCT
CTTTCTTAGCAAAACAGAAAGTGGGTATATATGTGTGACAGACACAAGATGTATCTGTAG
TTTTGTTTGGCTAAGGAGATAGTCTCAAAACAAATTGAGATGGATTTGTTTGTGTCTTGG
AGTAGGGTGAAAAAAATACAATTCATTATTTGAATAATGCTGTTTATTGTTTTTAGAACC
TGCACTTGTTGCCAAGTCTTCCATCTTACTAGATGTGAAACCTTGGGATGATGAGACAGA
TATGGCGAAATTAGAGGAGTGCGTCAGAAGCATTCAAGCAGACGGCTTAGTCTGGGGCTC
ATGTGAGTTTAGGCTTTGCCTTTTTTTTTTTGAAACTAACATCTGGAATTTGCCTACAGT
TTCAACCTTTCCTACAAGACTTTTCTAACTAGGATTTTTCTTAATGCTCTTTTTAGCTAA
ACTAGTTCCAGTGGGATACGGAATTAAGAAACTTCAAATACAGTGTGTAGTTGAAGATGA
TAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTC
CATGGATGTGGCTGCTTTCAACAAGATCTAAAATCCATCCTGGATCATGGCATTTAAATA
AAAGATTGAAAGATTACCTTTGGCTCTTGAGTATGTTACATAGGAGGGTGGTGTATATAT
TCCTTTCATTTTGGGGGAAGGAATTAAATGAATATGTGATTCCTAAATACCCCAAATTTG
GTTTGGCATTGTTGTTAGAAAATTGCAGTGCAGGCCAGGTGTGGTGGTTCATGCCTGTAA
TCCCAGCAGTTTGGGAGGCTGAAGTGGCTGGATCGAGACCAGGAGGCTGATACCAGCCTG
GGCAATGGGGAGAGATCCTGTCTCTACAAAAAATATAAAAATTAGCTGGACATGGTAGTG
CACCCCTGTATTCCCAGCTATTTGGGAGACTGAGGTGGGAGGATTTCTTGAACCCAGGAG
GTTGAAACTGCAGTGAGCCAAGGTTGTGCGACTGCACTCCAGCCTGGGTGCCAGAGCAAG
GTCCTGTCAAAAGAAAAAAAATTGTAGTGCAACTTTACCCACTTGTGATGTCCTTAGCAG
TGCCTGATGATGTGATTTGTTGTAACCTAGCATCTTTGCACTGGGAACTTGATGTGAGAT
GTGTGACACTGCTAGAAGACACCTAACCCAGAGGAGGGAGGGCTTCCCAGAATTTGGCAT
GACTTACAACTACTTAACAGGTTACAAATTTAAAATAATGACTCATGATGTAAAGAAACC
ATCTTTTAAGTGTTGGGAATGTGATTTGGAGTAGCACTGTGTCCTGGGAGGGGGATTATA
TAGGTAACTGGTTCCCAGGCTTCCCAGAAAAACTTGACTTTGCTGTGAAGATTCATAGGT
GCTGGGTTGTAGAGGCGGAATATTTTACTTGGATTTGGAAATCTGATTGGTTCTCATGCT
GCAGGTAAATACTGGGATGAGGGTAGTATGTTGAGTGAAGAGATGGTCAAGTATTGGAAA
CCGTTTAATCTTAACAGGGAATTTGGGGTCTGGCTAACATTTGATACATTTTTTTAAATA
GTAGTTTTACAAAAGCAGTGCTTGGGAATTGCTGATCTCAAATGATCAAAAAATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1466, 1995..2117, 2753..2879, 3445..3511, 3896..4021, 4136..4334
1387..1466, 1995..2117, 2753..2879, 3445..3511, 3896..4021, 4136..4287
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved