Homo_sapiens Locus C20orf198
snOPY snoRNA Orthological Gene Database
Homo_sapiens C20orf198
Homo_sapiens
C20orf198
20
SNORA39, SNORA60
2403..2534, 3689..3822
6240
GAGAGAGGCAGAGTTGCAGGACAGGGATGGAATTCCAGTTCTGGTGTTTGTTGTCTTGG
AGGCCCAGCTTGACCTCTGCCCTTCCCTTCGCTTGATTATATAAGTTTTCCAATAATGTA
TTTTATTTTTAAAGCGTAAGTTAGGTTTCTATCACCAACACATTCTATCTAAAAGCCCAA
GTCTTTTCCTTAACTTGTCCTAAATGGCCAGTTATTAAGAAATTCCATTGAGGGTTTGGC
TGTTGCATACAGCCTTGTGGGCATTTTGCTTATCCACGTTGACTTTCTCATCTGGGACAC
TGGCCTACGTAGTACGTGATTCCAGCAAACAGGGCAGTATGTTGAGCTCTTGAAATAAGT
ATGTTGTGACAGCCTTTGTTACAGCATTAAAAGAACAGTCTACTCTCAATGGCTGACCCT
TTATTTGTATGCTGACGTCAAAAACAAAACAAGACTGCAGACACACTCTTGCCAATGCTA
GAAAGGATGCATGTTTGAAGTGGATTTTTTTCTATTTTTTTGCTTGGAGAGGAGGGTGTG
TGGACACCAAGCTGGCCATGGTCCAAGCTGACCTATTTGCCAGCCGACCCCTGTCTGGGC
TGCCATAACAAAGTGCCATCATGAACTGGGTGGCTTATAAACAACAGAAATTTATTTCTC
ACAGTTCTGGAGGCTAAAAGTCCAAGATCAAAGGCACCAGTAGATTTGGTAAACTAGGAA
GCGGTGAGGGCCCACTTCCTGGTTTATAGACTGATGGCTGTCTTCTCACTGTGTCCTCAA
ATGGAAGCTGATGTTTCACAAATATTTTCTGGGTAAATGGATGGGTGAGTGAACTCATGA
AGGGATGCTCCATTAGATGAACGCTTGGATAAAGGGCGTTAGTGGAGGGACAGAATTGCA
GCTCCGTCCTCCCAGGGGGCGCTGCAGGCACGTCTGCTTGGGCAGGGGCCCGGCGGAAGC
GCCGCTCTAGGCTGCAGCCGCGCCCCCAGCCGTATTTCCGCGGGCGCTGAGCACTAGAGA
GAGCGTCTTGTGGCTGCGGCCTGCCCCTCAGCCTCCTCCGCGCGGTTACCCCTGTACCCG
CCGCCATCCGTCCTGGCGCTCCGGATGAGTCAATGAGGGGCAGGGCCCGAGGAGTGGTCT
TCCCAAGAACCCCTGGTGGCCTCCCAAGGCCGGTGCTGTGTACCTCCTCCCCGACAAAAG
GGGAAACTGAGGCCCCGAGGGGAGTGGGAAGAGCCGGCTGGACGTCAGGCCCAGCCGCTG
GTGCAGTGGTCCGTCCCCTCTGCCGGGGTGGGCCCCTCGGGTTTCGCGTGTCCTCGGGAA
AGAGACTGGCGGGTGAGCCGCGCCCTCGGCCTTCGCTGGGCTAAGCCGACCCCATGCAGA
CGTCAAACCCCCCTAGGTCGGCACAGCCTCTCTGCGGGGAGGCTTAGTGCCCCCTTGAGA
AACGGCTTGGCAACGCTGTGCCCGGGGCCTTGCACGCGGGCTGAGGGGGCTAGAGACCTC
GCGACTTTTACTCCCCCGACCCCGATCTCCGACTCCTGACTTTGGAAGCCCCCAAAGCTG
CTTTTCGGTTGCCTACAAAGTGTCGGTCATTGTGCCACGTCCTTGGAACCGTGAACTCAT
TTTCTCCTCAATAACCTTTAAAAAGTAGCTGTAAAACCTCCATTTTACAGACCAGTTGGC
TGAGGTTTAAATGGAGGACGCTCCCAGGGCCCCAGAGGGGCGAATTCCAGACTCCTTTGC
CAGGACCTTGTACTAAGCCCCTTCCCTACGCTTTTCCCTGCCTAGGCCTCGTGGGCTGTG
CGGCTATCCTGGAGACAGATGACAGCTCTCCCTTGGATGGCTTTGCTGGTTCCGCACCAG
CCAGCGCCCCCATTTTTCCTGCAGCACCCTGATCTGCACTCCCTGAGGGGCTCCCACTGT
CCGCGGTGTGAGGATGTCCCTGGGTAAGTGGTGCTGGTCATGAGCACTTTGGGGGACCCT
TCAAATTCCCTTCTGGGGGACCCCAGCGGAGGGCATGGTCATGAATTCCGAGAACTGTAT
GGCAAAGCCGGGTGCAGAGGAGAGCCTGGCTAAGTTCTTTCATTCTCCTGAGCTTGACTT
TCTGTAATGTAGGGAAACTGCGAAAGCTCTGTAAGTGGGGAGATCTTGCACGTTTTTCTT
GCTTTTGAACCCATGATGTCTGGCTACTTGTAGATACTCAATATTTGTGGGATGAATGAA
CAATTTAAGCCTTTTTTTTTTTTAACCAGAAATTGGTCTTCTGTGACTTTCTTGATGGGG
GCAGATGAGATCTTTGTACTGCATTAAGTGGATAGCGCTCAGGTCCTTTGGGCTTGGCGC
TTTGGCAATCTCCAGGCAGCTCACTTTGGCCTCTGTTCCTGGATCCCCTTTGCTCTTTTC
TGCGCCTGCATTCGTAAGTGATCACGGGCTGCCCGTGTCCTGGTCATTGGTAGTGCAGGC
AGAGGAAATGCGGGAAAGGTTGCTGTGTTTGGAGGGTCCACATCTTCACCCTCCTGTCCC
AGGAGCTTTCCTACACTCCTCCTTCTCAAAGCTGCACACACCTGGGGCCTCCAGGGGATT
GGGGGCTGCCGTGTGTGTTATATCATGATTAGAGCTTTCACTTCCTGCTCCCTGCTGTTG
GGAACCAGGCTGTGTGTGTTGCTTAAATTCCCCTTGATGACCAGCAGAGTCACTGCCACT
CAGCCATGGCACACTGCTGTAAACCTGGTTTTGATCTCCTTTCAATCTTTTGCTGATTAA
CTACACATTGATCAGTGTTGGCCACCCTCACCCTGCCATAGACCATCCGCTGTCTTCCTC
TGTAGAGTTAACTATTTTCTCTTTTATGAGGAAATAGTGTGTTTGCTTAGGAGTGTTTAC
TGTCTGGTAACTACTGTGCTAAGCCCTTTCCTGTTGCCTGCCATCCCTGCTGCGAGCAGG
GACAAGCTGGGTGCTCACTCATGGCATCTTATCTGTTGCAGATAGTCCACTGTGTGCAGA
GGCATGGGAGTTGTCATGTTGGGAACATGCTAGACCTCAGTATCCTTGAGGTAAGATCTC
TGGTTCATTCTCTGGAATGTTGGTTCCTTGTATCTAGTACAGTTCTGTACATGTTCCCAG
GGGCTTTGGGGTTGGTGTAGGGGAGCTGAGAGGTGAGATGAGAATGGCACTGTGGGTCCC
CAGATCCGCTGTCCACCCAGCCAACCCAGATCACCTCTGGCCTTTCCTGTGCCTTCCGGG
CTTGCTGCTGGGGGGAAACCTCCAGAGTCCCACTTTGGTAATAAGAGGTCTCTGCCCTTT
CTCCCTGGGCAGCAGGATGTTGTAATGGAAAATGAGTGGACCTAGGCTTCAGAGACTCTG
GTCCCCTGGCTTTGAATCCCCTTCTGCCACTATCCCAGTCAAGGACTGATTCAGAACCTA
ATTTTCTTCATTTGGAAAATAATGTTCTGATAGAGGTGACTTTTGTGGTACTTGAGACCA
TATGATTCCTATCATTACCAACCAATATTTTCCGATTGTTTTTGCCCCATGTGACTTCTC
TGTGATTCCTCCTGGCAAGGAAGTTTTACAGGAAAGCAGGGCCACTTTTGGGATCCTGTG
CTGGGCTGGATCATTTTCCTGGACTGGACCTAGTCCACAAGCTGCTGGCATCTGTTTCTC
CTCATGGATCTCTCTCTGCCCTTGTATACACCTGCATTCAAAAATGATCACGGGCTGCCT
GTGCTCTGGTCATCAATAACGCAGGGAGAGGAATTGCTGAAAGCCGTTTCCCGTGTTTGG
AGGGTTCACACCTGTCCCTTTCAAATGCTGGCGCTTTCACACACTCCTTCTCTCCTGCCA
GCACCTTCTGGTCTCAGGAGCATTGCAGGATGTTGTGTGAGTGAGTGATGGGAGACACTT
TAGTATGGCTTTTTTCAGCTTAGCCTCCTGTTATCAGAGAGCAGTCTCTTTCAGTGTCAA
GGTTTGAGTACTAGATGGTGGAGAAAGCCTGTGTGAATTATTTTTAATGAATAAGTGTGA
TGATGGGTGGCATACAGTCACTGCCTTAAGATTTTCAAAGAGAAGCAGCCTTTTGGAGGT
GGTGGGCCTGGGCAGGTCTTTCAAGGAGTGGGATGTGATGGGCAGTAGAAAGGTATTCCA
GGGAGGGGTAGCAACATGAGAAGGTCTTTCAAGGATTGGGATGTGATGGGCAGTAGAAAG
GTATTCCAGGGAGGGGTAGCAGCATGAGAAGGTCTTTGAGTCTGGGATGAGCAAGAGTGT
CTAGTCCCACCAGGGAGACAGATGTGTAGGCAAGTAATGACAGCATGGAGGGATGGCTGC
TGGGGTGATCCTTGGCTCCCAGCACGGCGAGGTGGACATCTATGGGAGGGGCCCTGAGAG
GTCTCTTGAGCTGTCTTTCTGCCAGTTGCACATCTGCTCAGTTGCCTGTTAAGACTCTTA
AGACAGTTTTGCTGGACTCTTAAGTTTTTATTTTGATATTCTTTGGGAGCATTGAGATTC
CTTTTTGAGATGAGTTTGGTATGAAAGAAACTGGCAACTCATACCTGATTGATTAACTGG
GGGCATTCCCATTGACATCAGCTTGAAGAAAGACGACAGAACACTGGAGACCAAGTACTT
ACAGCCTTCTGCTCTGTGGCCCCTCCTCACTCCAGGGATGCTGCCTTGGGTCTGGAAACT
GTTAGAGGAAACCCCAAGAGGTGCAGGCACTGAGCCTCTCAGGACAATGACCTGGGGTCC
CAGCTCCCCTGGAGGGGCCTCCTCATGGTAAGTGAATGCCAAGAGGTTAAGTTGGCCTGT
GTTTCCGAGGTGGAAATTCCAGGTCGCTGGCTTCATTTGTCTTCTCTTTTAGATTGTTTG
GGGGTTGATCACAGACCAAGAGTGACGAGTGATGTCACCCTGTGACTCATGGCTGGACCT
TCTTGCCCCTATTGTCTCAGCACAACATTATTCGACTTTTCCCTCAGCGTGGGTGGGCAG
AGGAAAAGCCCTGTGGCTCTGGGGACTTGGGATCCAGAGTTGAAGACCCTTCAGCTGGCT
CTGCCCTGCCAGTGCCACAGAGTGCCATGGCCCAGGAAGACAGGTTTTCTTCCATCTAGG
CCAGGCCATCCAGTGGCCATCCTCCGTGTCCTCCCGCCTCCTCCTGGTGTGACTTCTGAA
AACCAAGAATTTGTTCCTGTTGACTTTTTCTGTGCTATGGACCATTGTCCTCTCACCCAC
TCAATAAATCTTGAAACATGCCCTGCTGCTTGTTCTTTCATTTTTGTGTGTTTGGTTTTT
TTTTAATCAGTATCTCCGTGTGCCAGCAAGACTGGGTGTAGAGAGTGGGTCACAAGGGCA
GGTCTTCTGGTTCTCACTCATTAAGACTTTCCCCTTGACACATACCCAAGGCTTGACCTA
GGGAATGTGAGATGGGACGTGGGATTTGGACCGGGGTTGAACAATAATCCCAAGTGCATC
TAGGGGTGGGGGGGTTCAGGCTTAGGAGAGAAGGGGAACTCTTAGGATTAAGTTGGCAGG
GGAAACATTTGAGCCAAGGCTTTGGGAGAGAAGACTATGACGGGATAACTTAGGGATGGA
GGCAGGGGCTGGAGTCCTTGAAGAATGCAAGAGTGCCCTGAGCTCAGGTGGTGGATTGCA
GGTGAATGTAGGAGTTGGTTTTGAGCAGAGGAGAGAGTGGAGTATATGAGGAATAGCTGC
ACTTGGAGAGCTCTGGGGGTGTGGCAGGCAGTGCCAGCCGCTGGGGCTTCTGTTACCATG
AGATAGATTTGGTCTTTGGGGATTCTCTTTGGTAGCAGTGATCGCAGTGATGTGCTTACG
TGTGCATTGTATGTGTGTCACCACCTCCATATGTTGCTCTGTCCTCATTTTTCAGGTAAA
TTTCACACAAGAATGCTCCCAAAGGCTATGGTAGAAAGTTGGGAGTCAGTTGGTCCCACT
CCTTCAGTTGAAATAGAAATCACTGTGACTAAGCCGGGCATGGTGGCTCACGCCTGTAAT
CCCAGCACTTTGGGAGTCTGAGGCGGGTGAATCACTTGAGGTCAGGAGTTCGAGACCAGC
CTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAAAAATTAGGCATGGTGGCAG
GCACCTATATTCCCAGCTACTCAGGAGGCTGACGCAGGAGAATCATTTGAACCCGGGAGG
TGGAGGTTGCAGTGAGCCAAGATTACGCCACTGCACTCCAGCCTAGGCAACAGAGTGAGA
C
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1331, 1785..1942, 2981..3049, 4655..4766, 4852..5240
1112..1331, 1785..1888
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved