Homo_sapiens Locus Mono:232:AC092814.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:232:AC092814.2
Homo_sapiens
Mono:232:AC092814.2
1
SNORA26L8
1001..1122
2122
TGCAAATATTCACAGCAGCTTTATTCATTAATAGCCCCAAACTGGAAACACATATGTTA
ATCAACTAGTGGATGAATAAACAAATTGTGGTATATCCATACAATGAACTACTACTCAGC
AATAAAAAAGGAACCAGTTACTGATGCATACAACAACAAAGGTGGATCTCTGTTGTGCAG
CTTTGAAATGATTACAAACACATAGTCTGCTATTGTGAGTGAAATTTTCTGCTGTGATAA
GAACATGGAGTGTAATCTCCCTCCCTGATGACATGGCTCCTAGCATTGAAAATCTTGTTG
TCATCATGGATCTCCACTGTTGGTCTGATCATCTCTCCAGAGAACATCTCATAGAAAGGT
ACACCTCAAACTTCAATTAGACTACATTCACAGAGGCCTGTTTCCATCCTAAATGCGCAA
CTAGACTTTACTAATTTGACTCTAAATGAAACTAGTATTCACTCACATGTGGTTTCTGGA
CTTTGTCTATCAAACGTGTTCCCTGTGAGATGTGTTCTTGTTATTCTCCCTCTCTAAACA
TTGTGAAAAAGGCAGGGAAAATTCTTTCTGTATGGTAATAAACTGCGTGATTTGTGAAAT
CATACCTTATTTTAACCACATAAAACGATCTCAAAATCATTATGCTGAGTGAAAGAAGCC
AGACCTGAAGGACTACACTTAACTTACTGTATCATTCTATTTTATATGACATTATGGAAG
AGGCAAAACTATAGGGATAAAAAACAGATTGGTGGTAGCCAGGAGCTAGAGAGAGGGAAC
TGACTGCACAGGGGCATGAGGAAAGTTTTTGGGGTAAAGGAAATATTCTATGTCTTGACT
ATGGTCATGGTTTCATGACTGCATACATTTGGTGAATTTTATCTGATACAAATTATACCT
CACTAAATCTGATATTTAAAAAATTAAAAAAAAAACCCAACCAAGAAAAAAGAGTTAATA
TTCAATTTTCTAAAAAATGCATTAAGAATTTGCCCTTTCTTATGCCCTTTTAAGGTTGAT
GTGGTGCTTTAAGAAGCTAACATAGAAGGATAAAGTAAGTCTCTACAAAACCCAGAGAAG
AGACTGGAAAACTCCTCTCTGGATCCTGCCTGGAGTCACAGCTGTACCAGGAAAAAAAAA
AAAAAATTCACTAAGAATGAATACCTTGGTAAGGATTTAACAGCATCAATTTCAAATGTC
TCTGTTTAGTATTTTACCAGTCACAAAATGCTGATTATGTCCTCACAGGAATAAGTATCT
TAGAATATCTCTGTCCAGTAACCTTTGATTATTCTTAAAAAAAACAACAAAGGAGGCCAG
GCACAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCTGGCAGATCACCT
GAGGCCAGGAGTTCAAGACCAGCCTGGGCAACATGGTAAAACCCCGTTTAAATACAAAAA
TTAGCCCAGCGTGATGGCAGGCACCTGTAATCACAGCTACTAGGGAGGCTGAGGCATGAG
AACTGCTTGAACTCGGGAGGCGGAGGTTGCAGTGAGCCAATATCACGCCACTGCACTCCA
GCCTGGGTGACAGAGACCCTGTCTCCAAAAAAAACAAAAAGACAAAGGAAATCTGAAGGC
TTTTCCTAGTTGCCACAATGTTTCATACAAAAGACAACCACAAAGTAAAACTGCATAGGT
AATTTCTATCATTTACTAATGGGTGATGTTCCGTAATGCACTCATGTTAGTTATTCAGTA
CTTAGAACATTATTTCCTCATAGGAAAATAATAGCACTATCGGCACTCACAGTACTCTGG
AACCTAATAACCATTTATAATAAATGTTTCTATGGGAAAATTAATTAACATTTCTAACTG
AGATAGAACACATCCCTCCTTCATCTGCTCCCTCCTCCCCTTCACCCTCTTACACACACA
AAGAACTGCCTCTGAAGCTCTAGAAATCCTTTTCCTATCAAACACAACGCCAAAAGGGAT
AATTCTAAGTAGCTGGCAGTGTGGCTCATGTAGCCTTACTTTTCTAAAAGCCTGATATGA
AAAACGGGTCAAGGGACACACAGGGCAGAGAAGGGGAAAGACATAGCTGAGGATGGAGGT
GAGAAGGAACAGAGATGTGTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved