Homo_sapiens Locus Mono:163:AC094019.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:163:AC094019.2
Homo_sapiens
Mono:163:AC094019.2
3
SNORA25L5
1001..1128
2128
TACCATGGGGTAAACCACCAGTGCCTTCCCAACTTAGTAAGATGCTGGTCCCTGAAAGG
AGTGATAGATAAGGAAGACCACTTGCCAAAATCTGAGAGACGTTTCCACTAAATGCAATG
TGTTGGGACACTAACAGTAGACACATTCATAGGCCAGGGATGGTAGCTCATGCCTGTAGT
CCCACCACTTTGGGAGTCTGAGGCAGGAGGATTGCTTGAGCCCAGGAGTTTGAGGCTGCA
GTGAGCCACGATGGCACCACTGCACTCCAGCCTGGGCAACAGAGTGAGACTCGTGTCTCA
AAAAAAAAAAAGAAAAAGAAAAAAACCCACATTCCTGATGATACTCACTCGGCTCTTGAA
CCATGGACAGCCACAAGGAGCTTACTTATCCTCATTCTAACCAAGCAACTAGGCAGAAGT
CCTACTAGTATAGACAGGCTGGCTTGATCTAAACTGATCTAAACCAAAGTTTTACCTTAC
TACCCCCAACCCCCACCTGCCTCTTTCTGTAACCATTCAGTGACAATTACTAGGACTTGA
TGTATCCACTGCCTAGCCCAGGGGCATCTTGGGAGATGAGTATCCTGTCAGGCAGTACCC
CTAGAACAGTACATGCTGGAAGAAAAGCTCCCCTACGTACCCCGTGTGACAGAGAGAACA
GGAACTGCGGGCTCACTGGGAGAGCTGGTTACACAAGCAGGAGGCAGTCAGCCTTCTGTG
ACTGCACTGCCCTCTGCAGAAGCTTTCATTTGTTTAGGCATGTTCTTGAACTGGTATTGC
AGTCAGAAAATCCTAGAATGAAAACAGGAAAAAAGTTTTGCTTCTTTCAGAAAGCCCACT
AAGGGCCAGGTGTGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCAGGGTGGGA
GGACTGTTTGAGGCCAGGAGTACAAGACCAGACTGGGCAACATAGCAAGACCCCCATTTC
TAAAAAAATTTTTTTTTTCAATTTTTTTAACGAGAAAAGATAGGTCATTTCAAAGAGGTC
TTGTGAGGCTGTGAAACCAAGAGCTCTTAACACTGCGACCAAAGATGGAAGTTCTCTATA
GGATGCCATGGCATTTGATGGTGCTATGTTTTCTTGAGGAGATATAAGAAAAAAGAAAAA
GAAAAAAAATGATAAAAGAGAATCCACTAGGCACCAGAAATTGCTCTGGGGAGAGTGCAG
ATCAACCTCCACCCAGTTGTCTCTCAGCCTGAGGGGGGAAATCTGACACTTCCTCTGCAG
CGGAGGGAGAGAAGAACAGCCCACATATCTGCCCAGTGACAATCCCAGGCCTTGAAAGAG
CTCACTGCTTCATGGAGGAGTGAAAACAGACTTCATATATCCTAGGAAAGACTCTGCAAC
TTAAGGGAAAGGGAGCATTGTCCTGAGATCTTAGAGAGAAAACACTGCTGTGAAATGTTT
TTATATCAGAACAGAGAAAGATTTTAGAAAATATCCACAATTTATGGAGCAATGTACCAG
AGATAAGGAAGTTGTACCAAGAGAGAGTTCCAGAGATCTGCAGTGTTCCCTCGAGCCTTT
GCAAAGTATGGCTTTCCACAGTCTTAGGAGGAAGCTACATGAGTCCAGGGAAAGAGCCCT
TAGAAAGATGTGGATAAGCACAATCTAAAAAGTCAGAATGTATTACCTGCTGCATACAAT
ACATGCTACAACACAGGCGAGCCCCAAAAACATTACGGCCAGGAGAAAAAGCCAGATGCA
AAAGACCACATGATATAACAGGATTCCATTTATAATGAAATATCCAGAAAAACCAAGTAT
TTTTCCTTTTTTTTCTTTTGAGCCAGCGTCTCACTCTGTCAGCCAGGCTGCAATGGTGCA
ATATTGGCTCAGCACAATCTCCGGCTCCCGGGTTCAAGTGATTCTTGTTGCTTCAGCCTC
CGGAGTAGCTGGGATTACAGGCGTGTGCCACCACACCCAACTAATTTTTGTATTTTTTAT
AGAAACAGGGTTTCACCTTGTTGGTCAGGCTGGTCTCAAACTCCTGGCCTCAAGTGATCC
ATCCACCTCGGTCTCCCAAAGTGCTGGGATTACAGGCGTCAGTCATCACACCCAGCCAGA
AAAAGCAAATTTATAGATACCGAAATCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved