Homo_sapiens Locus Mono:191:AC004830.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:191:AC004830.1
Homo_sapiens
Mono:191:AC004830.1
7
SNORA4L1
1001..1144
2144
AGGATATGACCCTAGAGCAGATTTTCTTTCTTAAGTCACTTGGGAACACATTAATGGCA
GGTTTTTACGAAATCGGAATCATGTTAACAAATAGTATAAGCACAAACATAGTATGATTT
CCATTCCATCACCTGAGGAATACCTGTTTACCCTCCCATGATAAACAACTAGAAAACTGG
ACAAAATGTATGAAACAATTTTGTGGATATTGATCAATAAGCAGAACCTATGATAGCTGG
GAGGAGAAGAAGGAAGGTAAATTCTTATAATAACCTTGGTTTTTCTGCATGGTGGATATT
TTCAGACTGTGGCACAGGGAGGAAAATAAAACAGCTTGGCAATCTTGCTGAGTAGAAGAA
ACAGATTAAAGTTCAGGGAAGTCAAAGTAGCTAGAATTTTCAGAGCAAAGTACCAGGAAG
AGGGGAGCTAAACAGACAGAGTCCACTTTTGTGGAGGTCAAACATCCCCCTAATTTGTTG
TATCAATAAAAATTCAGGCACACATAAATGAAATTTCTGGAGGCCAGGCAAAGAAAAACA
ACTGAGGAAACAACTAGGGAGCTACAAGCCAGAAGATTTCCAGAACTCATACAGTGCTCA
GTTCCCATCAGCCAGAGTAGCCAGATCTTGAGAAATATATGGACATTCAGGAGAGACTCT
GAAAGGTTCCTGACTTAAAAGTGGTGGCAGAATTCAGTTAAAAAATTACTGGACATATGA
AGTAGCAAAAGTACGTGTACTAGAATCAGTCAGTAGAAACAGAACCAGAAATAACCAAAA
AATATGAAATTAGCAAACAAAAACCCTAAAACAGCTATTATAATTTTTAAAAATATACTC
AAAGATTTAAAGGAAAACATGAACATAATTAGGAAAGAAATAGAAGATATAAGAAAGAAC
CAAATGGAACAGCTAAAAGGAAAAAACTACAAAATATGGAGTACAAAAATCACTAAGATT
TTAAAAATTAAAAGCAAATTAAACCCTAAAGAAACAAAGACCTATCAAAAGTTACTTTTT
GTGGGGTGGAAGTTTTTAAAATAACCTTTACCTACGTGGGCTGTTTTGGAAAATAAAGAA
AAGACCACACTCAGCAGAGGGCTATACCCCTTAGTATAGTTCACCACTATTTTGCAGCTT
ATATTACATAAGTGAAAAAGAAAAAAAAGGAAATAAAGATCAATGAGCCTGAAGTCATAG
CAATAGAAAGGATTGAAACTAAGGCAGAGAGTAAAAAGGAAAAAACAGGGAAGACAGAGG
AGGAGGAGGGGAAGAAGGAGAAGAAAAGCTTCTGTGGCCTGTGGAACAACAGCAAATGTT
CTAACAGCTGTGCTGTTGGAGTTCTAGAAACTGAGAAGAGAAAGAAAGAAACATAAAAAT
TAGTGAAAGAAATCATGGCCAAAACATTACCAAATTTGATGAAAACTATCCACCATAGAT
CCAAGAAGTTCTATCAACCCAAAGCTAGATTTAAAAAAAAAACACACATAGACACAAAAT
CAAAGTAAATTATAATTAAATTGATGAAATCATTGATATAAAAACCCTAAAAGCACCCAG
AAAAAAATATACAGAGAAAAAAATAAAAATTTACAGATTCCTTGTCAGAAACTAATGCAA
GTCAAAAGATAATAAATGTTACCATTAAAATGTTTAAAGAAGAAAAAAAATCTACCAACC
TATCAATCTACCAAAGCTATACTCAGTGAAAATATATTTCAAAATTGAAATTGAACAAGA
TCGTCTGTAGACAAACAAAACCTGAATTTCTTTACCAGCAGAAATAAACAGCTTTTAAAA
GAAGATCCTCAGATCGAGTAAAAATGATACTAGAAGAAAGTATAGTACACAAAGAAGGAA
AGGGTGCTAGAAATTTTTTCTCATTTCACTTTTCTTCTTTAAAAAATTTTTTGGAAAGTT
AATTAACCATTTAAAGCAGAACTTATAGCAATATCTCTTGGGATTTATAGCTAGTAGAAG
TAAAACGTATAACAACATAAAAAACAGAAAGAAGGAAATAGATTATACTGCCGTAATTCT
TACATCATACATGCAGTGGCATAATATTATTTAAAGGTAGACTGTGATAAGTTAAGTACA
TGTAACCCTTAATCAGTGGTTCTCAAACATTAGTGTAAACTAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved