Homo_sapiens Locus Mono:36:AC092630.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:36:AC092630.3
Homo_sapiens
Mono:36:AC092630.3
2
SNORD78L2
1001..1069
2069
GACAATGACTTTGCCATTTCAACTTTTCATTTCAATGTTTCCCTTTGTTAAGTAGGTAC
AGAAAGATTTTCACAAAAGAAAAAATCCACGTGGGAAAGGGCAGAAACCCAAAAAACTCT
AGAATCTAAGACAGAAGAACTGAAGAACCCTGGCATGCACCAACATTTAAACGGAGATTT
GCTGGTTTCCAATTTTAACGGGGAAGACTGTTAATCACAAAACATCAAGTAGAGACTTGA
AAAAGTTAATATTGATTCTTTAGAAAAAGTCCAGGAAATAGAAAAAGCCACCAACCTCAC
TTCCTTAAGCCAATATTCAGCCCCCTAACTGTGTCCAACTTGGAGAGAATTTGCCACAAG
CCAAAGCTTTTAATGTCCCTACCTTTTGAAGGCACAGTAGTAACAATTCCCAGAACAAGG
GAGTTGCGTCAGTGAACTCTCTGCTCTTTCAAGTTGGAAGGACAGTTGATTCACACCATG
TGTCAGAGAGAAACACCAGTGAAAACCAAGTGAGATAAATTTTAGGTCTCCAGAGCTGTT
TAATATTAAGCTGTATTAAATCATTGTTATAGCAAATTATAAACAAAATATTTTGTTTAC
CCTTCCTCTCATATGCTCCTTCTCTTGAAAAGAAATTTTAAGATAATTCATAGTTCCAAG
GTCACAGATGCTCCACCAAAAAAAATCATTTCCAAATGTTAGCATCCAGAACCAATGATC
TGGATCATACTCCCAGCAAACTTCCCTGGCATATCATAGAGTAAGCTTTGCTACATAACC
TTTTAGGTTTCAAGACAGTGTTAGTTTACTGATGGTCACAGACTTAGAGGAAGACTTCAC
TTTTGTCAACTGTCTCTACATGAAGTCATCTTAGTGTCCATTCTATTCAATAATTTTACT
TTCTACTTAGATCAAGAAATCAACTATATGTTAAACTCCATAAATAATACTAAGTTGATT
TTGTTTTTAATACTATGAATGGTACGACTAAAACGTGAAACATGTAATAATGTTCATCAA
ATGTCTGACCTGAAATGAGCATGTAGACAAGTTAATTTAACACTGAAGAAGAAAAGAAAA
AAGACCTGAAACAACCTTGATCTACATGAATTTATTTGAAAAAATGGTCCTAGAGCAATG
AAAATAAAATTTAACACAAGTGATAACAAAACTCAAACCATAAAAGTTGAGGAAAAACTA
AACCAACAATACAAATATTTTAAGATAAAGCTTAACATGTTAAGAGACATCTTTCTGAAA
AGAGAGACCACTAAAACTGCATGATTAGTTCAATACAAGGAATTAAAAAATTACAATGGG
TAACTGTGGAAAGCAAATTTCACTTCTCTCAAAAATGACATATGATGCCAGGCAGGGGGG
CTCATGCCTGTAATCCCAACACTTTCGGAGGCTGAGACAGGTGAATCACCTGAGGTCAGG
ACTTCAGGACCAGCCTGGCCAACACGGCGAAACCCCATCTCTACTAAAAATACAAAAATT
AGCTGGGTGTGGTGGTGTGCACCTATTATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAA
TCACTTGAACCCAGGAGGAGGAGGTTGCAGTAAGCCGAGATTGTGCCACTGCACTGCAAC
CTGGCTGAAGAGCAAGACTCTGTCTCAAAAAAAAAAGACATATGATTAAAATTTGTTAGA
TATCTACCTGAGGCCTACTGTACATTTTCATTACTCTTCCATTATCAATAGATCAATCTG
GTTTGGGCTGTATAACTTCTTTAGAGAATCTGATATTCTACACAGGTGAACTCTAAACTC
AACAAAGTGATGATCTACTGTGACCCCAATCATCACTAAGAAACAAAGTTGCTTGCCAAT
AAATTACTTCTCCAAAGCATTGCATTTAGGGCACTCTCCAAAAGCTATGAAATATCACCA
CCACATTCTAGCTCTCCAATTTATAAGGTAACTTGATTATTTATTTAAAGAGGGAAAGCA
GCAGCATCTTTTTTTTTAATGTTCAAAATAGATCAAACTAAAATAGACTTTTAAAGGGCA
AGATAAATTTGACTATTAAATAATAAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved