Homo_sapiens Locus Mono:75:AC016180.14
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:75:AC016180.14
Homo_sapiens
Mono:75:AC016180.14
15
SNORD74L6
1001..1072
2072
CTATCACTAATAAGAAACTAGCTGAAAAATAAATCAAAAAAGCAATCCCATTTACAATA
GCTACAAAAAATAACAAAATGCCTAGAAATAAATTTAACCAATAGGTGAAAGACCTCTAG
AAGGAAAACTACAAAACACTGATGAAGAAATTGAAAAGGACACAAACAAATGGAAAGACA
CCCATGCTCATGGATTGAAAGAATTGATATTGTTAAAATTAATCTTGAGACTATACTACT
CCAAAGCAATCTACAGATTCAATGCAACCCCCATCAAAATACCAATGACATCCTTCACAG
AAATAGAGAAAAACCTCCAAAATTCATATGAAACCACAAAACACCCAAAATAGCCGAAGC
AATCCTAAGCAAAATGAACAAAGCTGGAGGCATTACACTACCTGCCTTCAAAATATAATA
CAAAGCTATAGCAACCAAATCAGCATGGTACTATCATAGAAACAGACATACAGACCAGCA
CAGCAGAACAGAAAACCCAGAAAGATATTCACCTATTTGTAGCCAATTGATTTTTGAAAA
AAGCACCAACAACATCCTTTGGGGAAAGGACACCCTCTTCAATAAATGATGATGGGAAAA
CTGGATATCCACATGCAGAAGAGTGAAACTAGACCCCTACCTCTCGGCACATACAAAAAT
CAACACAGAATGGATTAAAGACTTAAATATAAAACCCAAAACTATGAAACTACTAGAAGA
AAACACTGGAGAAATTCTTCAGAAGGTTGGTCTGGTTAAAGATTTTATGGCTAAGATCTC
AAAAGCACAGGCAACAAAAACACAAACAGACAAATGGGACTACATTAAACGAAAAAGCTT
CTGCACAGAAAAGGAAACAATCAGCAGAATGAAGAGACAACCTGCTGAATGAAAAAAAAA
ATATTTGCAAACTCTCTGGCGGGGGACTAATAACCAGAATATACAAGGAACCCAATTCAA
TAGCAAGAAAACATATAATTCCATTAAAAAGTAGACAAAGGTTTCTGATGAAGCCTATGT
TGGTAGAGACATCTGAGAGTATTGATGAATGCCAACAGCTTAAATGGAGAAAATGATAAT
AATAAAGTGGGCAAAGGATCTAAATAGACATTTCTCAAAAGAAGACATACAGGTGGCCAA
CAGATATATGAAAAAATGCTCACTATCACGAATCACCAAGAAAACACAAATCAAAACCGC
AATGAGATATCATCTTACTTTAGTTAGAATGGCTGTTATCAAAAAGACAAAAAAATAACA
GATGCTGGCAAGGATGTGGAGAAAAGGGAACTCGTATAGCCTGTTAGTCAGAATCTAAAT
TTATACAGCCATTATAGAAAACAATATGCAGGTTTTGAAAAAAAACTAAAAATAGGACTA
TCATGCAATCCAGTAATCACGCTATTGAATATTTAACCAAAAGAAAGGAAATCAGTATAT
TAAAGAGATACCTGCTTCCCATGTTTATTGCAGCACTATTCGCAAGAGCCAAGATATGGA
ATCAACCTAAGTGTTTATCAACAGATAAATGGATTTTTTAAATGTGGTCTATATCCATAA
TGGAATACTAGTCCACCATTAAACAAGAATGAAATCCTGTCATTTGCAGCAACATGGATG
GATCTGAAGGTCATTATGTTAAGTGAAATAAGCGAGACACAGACAACTACCACTCACATT
TTTCTCAGTCACATGTCTGAGCTAAAAAGTTGATCTCATGGGGATGAAAGTCGAATGATA
GTTACCAGAGGCTGGGAGTGGGGAAGGGAGAAGAGAAATCGGTTAATGTGGGTACAAACA
CAGTTAGATAGAAGGAATAGATTCCAGTGTTCAATAGCATAGTGAAGTGATGATAGGTAA
CAACGATATCTATTTCAAAATAACTAGAAGATTTGAAATATTCCCAACACAAAGAAATGA
TAACTGCCCAAGGTGATGGATATCCTAAACACTCTGATTTTATCATTACACATTGTGTGA
ATGTATCAAAATATCACATGTGCTCTATAAACATGTATAATTACTATATACCAATAAAAA
ATTTTAAGTGTGTTTCTTATATGCAGCACAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved