Homo_sapiens Locus Mono:274:AL136296.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:274:AL136296.3
Homo_sapiens
Mono:274:AL136296.3
14
SNORA42L2
1001..1137
2137
GGAGAAATCAGTTTAGCTGACTTCCTGACTTACTATATTACAGTCATTAAGATGGTGTG
GTCTTGGTGGATGGACAGGCCTGTAGATCAATGGGACAGAGTAGAAAACCCACAAATGGA
CTCCTACAGATATGCACAACTGATTTTTTATAAAAATGCAAAAATTATTCAATGGTGTAG
GATAGTCTTTTCAAACAATTGTTGCTCAATCAGTTGTACATCCCTTAGCCAGAAAAAGAA
CCCTGACCTAAGTCTTGCATCCTATAAAAAATGTACTTAAAATAATAATTCATAGACACA
TGTAAAATATAAAACTATTAAACTTGTAGAAAAAACATAGGAGATCTTTGGGATTTAGGG
CTAGGGAAAGCATTCTTACACTTGACCCCAAAAGCACTATTTGTAAAAGGAAAAATAGAT
AAATTGGACTTCATCAGAATTAATTTTTTTTTTCTCTACAAAAGACCCTGTTAAGAGGAT
TAAATACAAGCCACCGACTCGGAGAAAATATTTTGCAAAACACGTATCCGGCAAAGAATT
AATATCAGAATACATAATGAATTTTCAAAACTCAATATAAAAATATCTAACTGGAAAGTG
GGCAAAACCATTAATAAACATTTCACCACATAGGATATATAGATGGCAAAGAAGCATATG
AAAAGATGCGCAACATCATTAGCTATTAGGGAAATGCAAATTAAAACCACCATAAGATAT
TAGTACAGAATGGTTAAAATAAAATAATAGTGATAACACCAAATGCCAATAAGGAAGTGG
AGGAGAAATAGGATCATTGATATATTGTTTTTGGGAAGGTAAAATGGTACAGCCCTCTAG
AAAGCAGTTTGGTAATTAGAAAAAAACCCAAAGTATGCATGCAGTTCTGTAAGATAAAGT
GTCTGTCCAGGCATGCATACAACCCAGCAATTGCATGCCTGGGCGCTTACCTTACAGAAA
TGAAAATTTATAATTACATTATAATTTGTACACAAAATTCATCACAGCTTTATTAATAGA
AGCCAAACTCTCTGTGGGCTTCTCACAGTGTACCCATTGCCAGAGTAAACTGCAGCCTTG
AACCATTGCTCAGCCTCCTTACCCATGAGCTATGAACACTGAAGCAGGTTGCACAGTGAA
AAAAAAAAAAAAAAAACTCAAACAGGAAACACTCTGGATAACCTTCAGTGGGTTAAGAAA
ACTGTGGTACATCCACAGATGGAATACTAATCACCAATAAAAAGGAATTAACTATTCATA
CATGCGATAACAATGAATCTTAAGAGAATTGGGCTGAAAAATCCAATTCTAAAAGATTAC
ATACTGTGTAATTTCATTATATAACTTCCTCGAAATGACAAAATTATACAAATAAAGAAT
AGAATAGTGGTTTCCAGGTTTTCAGGATGGGGGTTAGGATGAGTATGACTTTAAAGGACA
AGATGGATCACTTGTGATGATGGAAATGTTTTGTAGCTTGACTGTTTCATGTCAACATGT
TGTTTATGATATGGTACTATGGTTTTGCCTGATGTTGTCTTTGGGCTAAACTGGATAAAG
GGAAGATGGGATATCTTTGTATTATTTCTTAAAACTGCCTGTGAATCTACAATTATCTCA
AAATAAAAATCCTAATAAAGAAATTATGGTCAGTGGAACAGAAAAAAAAAAAAGAAAAAT
AAGAAAAAAAATGTAGCCTCAGTTAAAAAGATAATTGTTACATGATGATTTGTACAATAA
AAAAGCTTGTTGCAATTGAAATCTGAAACTGTATTGATGACTTTCATACTTTATTATGTT
AAAATCTATTGTTTTATCTTGTACTTTGAATGGCTCTTTTACTCATGGATTATTTCAAAT
AACATCACACATTGGTTATTTGGAAAATACTCTTCAGTTATTTAACTCTTCAAATGTTGA
CACATTTCAGTATAATACACAATATCAAAATAGCTTATTTTTAAAATTGTCAGAAAAGTT
CTTTAGCATTGGGAACCTTGCAAAATCATGGTAAGGGACACATGTTTTCCAAAATTCTAA
TTTTTGTTCAAAAGCTCAGTTTTTTTCAGTGTCACAAATACACTCGGGTGTTTTATTTGA
AGTGACCAGTTTGCTTCATCCCTTTTCAAGAAAAATCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved