Homo_sapiens Locus Mono:117:AC080089.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:117:AC080089.5
Homo_sapiens
Mono:117:AC080089.5
4
SNORA11BL1
1001..1127
2127
TTTTCTCTAATAAATAGTTTTACAAAGTAAAGACATAAACTTTAAATCTGTGTTTTAAG
AAAGATGAGTTTCAAACAGATATAGAAAGTATTATGCAAAGTTTCTGATAAATATGCAGT
ACAAAAAGTATACATTGATATGCTATCTGTACCTGGAACTGTATGAAGCAATGTACTAAG
CAAGAAAATAAAGAGAAAGCTCCTGCTCACTCAAAAATATAAGAAGACAAAAAATCAGCT
GCTTATTAAATGATCACTAATCAAACTATATTAACATTTTAGTCCATCATCATATCAACA
TAAATTTACAGTGAGATGATGATTCCTTTCAGTCTTTTTTTTTTTTTTCTTTTTGAGACA
GGGTCTTGCTCTGTTGCCCAGGCTGGAGTACAGTGGCACAATCACAGCTCACTGCAGGCT
TGATCTTCGAGGCTGAGGCTATTCTCCAACCTCAGCTTCCAAGCAGCTGGGACTACTTGG
AAGGCATGTACTACCATGCCTGGTTAAATTTTAAAAATTTTTTTGTAGAGATGAGGTCTC
ACTATGCCCAGGCTGGTCTCACTATGCCCTGCACTCAAGCAATCCTCCTGCTCTGGCCTC
CCAAAGTGCTGGGATTACAAACATACAGTAAGATAGAAGAAATAAATTAAATGTTTTATA
GTATAGGAGGGTGACTATACTTAACAAAAATGTATTGTATTAGGGGTAATAGACACCAGA
AATACCCTCATTTGATCACTATGCATTATATACATGTAACAAAGTTTCACATATACCCTG
TAAATTTGTACCAATAAATAAAGAAATATTAAAAAAAAAACAAGTTCTGTCAAGAGACTA
TTAGACCAGGAAAATATAGTTGGTCCTTTGTATCCAACTGTGATAGAAAATGTTTGACAA
AAAAATTTTAAACCCACAGCAATAAAAATAACATAAAATAAATATAGTAGGACAATTACG
TACAGAGCACTCACATTATATTAGGTAGTATAAGTAATCTAGGGGTGTGCTCAGAGCAGG
GGGCTGAAGAATGGCTCCTCTGTTTATAACACATGGAACAGGCATCTGAGGTCACTGTGA
CAAGGGGCACAAAACTTGTGACTCCCTAAGAACAAATGTCCTACAAGTGTAACAAAAAAA
GTAATCCAGAGGTGATTTACAGTGTATGAGAGGATGTGCATAGGTTTTATGCAAATATTA
TGCCATTTTATATAAGGGACTTGGGCATCCACAGACTTTGGTATGAGGGGATGGAGTGGA
GTCCTCAAATCAATCCCTCTTTGTATACTAAGAGACAACTGTATATCTAACATGTATATG
TGCCTCCATCCCCAGAAGGATGACATTTGAAAAATGACACTGATAAAAACAGACAAAAAA
TAGAAGAAAAGGCATAGTGTTCATCCAGGGTTGCATACACAATAAAAGACAAATTAACAG
TTTAATTCTGACTTTAAGGATCCTGAGCAAAACTGGCATCCTCTGCCCTCATGTTCAAAT
AAATTCAGTCCTTCTTTCTGCTGTCATCCATTGCTTCTTTAAACAAATTAGATCATTGTC
TTTAAATCAAGTAACTGTTAACTATAGGCTTTGAAATGTCCATTTTTAATGACAGCTTTT
ACTCTAAGTATATCTCAGACTCCATGTGAGAGGCAGCACCCCTAAAAGCATTAGCTTCCA
TATCAGAATGTCCATTCACTTTTGCCTACCTGCTGGCTAACTGTACTCTCAGATATGGGC
ACTCCACGCTATTTCTGTAAAAGCGCAAAAAAGCCTTTCTGTTTTCTATTTTACTGGCAC
TATGCACAGCACAAATGGATGTTATGTCCTCACAGGGTCGAGTGTTCTTTTAGGAATGCA
AAGGCCAAGACTTGACTCTCACTGGGCGAGCAGTATGGAATGTGACAGCTGGTTGTTTCA
GGGCAACTGATCATTGCCACAGTGAGCAATTTCTTCTTCAATAAGCAGCTGCCCCAGACA
TTTACTGAGGTCATACATCAATCCCAATACATTTCCCCATCCCCGGTTCAGGGGATGCTC
AGCATGGAAACTAAAAGCAAAGGAGGAAAGGACAGACTACAAATCATAGCTATCCCTCTC
TCTCAGCCTCAGAAGATCTCCACTGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved