Homo_sapiens Locus Mono:53:AC023271.11
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:53:AC023271.11
Homo_sapiens
Mono:53:AC023271.11
2
SNORA1L4
1001..1134
2134
TTCAATTTTTAAAAATGAGCAAAAGATCTAAATAGACACTTCACCAAAGAAGATACAAA
TGGTATATAGCCATATGAAAAGATGGTGAACATCTTTTGTCATTAGGGAATTGCAAATTA
AAACAATAAGATACTACAAACACCTATTAAAATGGCTAAAATATAAAAGAATAGTATAAT
CCAGTATTGGAAACCATGAAGAGCAACAGGAACTCTCATTCATTGTTGGTGGGAATGCAA
AATGGTATAGCCATTTTGGTAGACAATTTTGCACTGACAAAGCTAAACATAAGCTTACCG
TATGATACAGCAATTATACTCTTCAGCATTTACCTAAATGAGTTGAAAACTTATGTGTAT
GCAAAATCTGCACACAGATGTTTTTAGCAGCTTTATTCATAACTTCCAAAAACTGGAAGT
AACCAAGATGTCCTGCAACAGGGGAATGAATAAACAAACTGTGGTATGTCCATAAGTAGA
GTATTATTCTGTGACAAAAGAAATGGGCTATCAAGCTACAAACACATGGAGGAGGACCAG
GTGCGGTGGTTCATGCCTATAGTCCCAGCACCTTGGGAGGTCAAGGCGGAAGGATCACTT
GAGCCCTGGAGTTTGAGACCAGCTTGAGCAACATGGCGAAACCCCTTCTCTACAAAAAAT
ACAAATAAATAAATAAATAAATAAATAAATAAATAAATAACTGGGCATGGTGGCATGTAC
CTGTAGTCTCAGCTACTCAGAGGCTAAGGTGGAAAGATAAATTGAGCCCAGGAGGTCAAG
GATGCAATGAGCCCTTATCAAGCAGCTGCACTCCAGCATGGGTGACAGAGTAAGACCTTG
TCTAACAAACAAACAAACAAACAAGAAAAGTCATGGAGGACCCTTAAATGCATACTGCTA
AGTGAAGGAAGCCAGTCTGAAAAGGCTACATTCTGTATGATTCTAATTATGACACCCTGG
TGAAAGCAAAACTAAAGACACCATTAAAATATCAGTGGTTAAGCCTCATTCTAGATGAGA
ATGGGTACTGCTGATCATGGTGTCCAAAAAACTTTATGTGGCTAAATTGAGACACAGGCT
ATGCTTCCATCACAGTACACATATTGCAGTGGTGACAATGAAACCTGTAACATTTGGTAT
GCTTATGATTAAAAAAAAAAAAAATCAGTGGTTGACAGAGGTTGGGGCGGGCAGGGGTAT
GGGGTGTGTGTGTGTGGGTGTGTAAGGAATGAATAGGTGGAGCACAGGCCATTTTTAGTG
TAGGAAAACTATTCTATATGATCCTATAATGATGATTATGTCAAATTTATATATGACAAC
ATAAATTAGTCAAAACCCATGAAACTATACAACACAAATAGTGAACCCTAATGTGCACAT
GGACCTTAGTTAATAATGTATAAATACTGGTTCATCAGCTGTAATAAATGTATCATACTA
ATGTAAGATATTAGTAATAGAGGAAACTGAGGGGTATGGGAAAGGAGTATGTGGGAATTC
TAGATTTATATAAAAACAGCTCTAAAACATAAAGTTTATTAAAGTTTTTAAATGGAGCTT
TAAAAAAGTAAAGTGAGGTCTCTGGAAATAGAAACATGTTCTGTGACTGGTAGCTATTGA
ACATTAAATTTATCATAAGAAACTATCTACTACCCAAAAAATTTTTTTTCAACCAAAAAA
TTTGTTGAGCATTTCAGTGCTTCCCTCTATTACCAAAATCTAAACATAATGAATTGAAAA
CAAATATCTGTAGGATTTTTGATTTCAGCAAAATTGTAGTAGGTAGCTAGCAGGAAAATA
TAGCAAATTATCAGAGGTCAACTTATGTCTTACTACCTGAATAAACCCTTTCCCTTTAAC
CTTTTTTTTTTTTTTGAGAAGAGTCTCGCTCCGTCACCCAGGCTGAAGTGCAATGGCATG
ATCTCGGCACACTGAAACCTCCGCCTCCCAGGTTCAAGCAATTTTCCTGCCTCTCAGCCT
CCTGAGTAGCTGGGATTTCAGGCACCCGCCACCATGCCTGGCTAATTTTTACATTTTTTT
GGAGAGACAGGGTTTCACCATGTTGGCCAAGCTGGTCTCAAACTCCTGACCTCAAGCGAT
CCACCTCCTCGGCCTTCCAAAGTGCTGGGATTACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved