Homo_sapiens Locus Mono:20:AL031684.14
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:20:AL031684.14
Homo_sapiens
Mono:20:AL031684.14
20
SNORD3@L15
1001..1202
2202
ATGCTAAAATCTTATATTTTAAGACTATTTCCCAAAGTTATTGACAAATTTTCTTTTTG
GTGGGAATGCTTGGTAAGTTTTAGACCTATAACGTTAATTGAACTAATTGAATATTAATA
TCAGTGTTTAATTTCATTCAAAACATTTTAACTTCTACTCAGTTCTCCAGGGTCTTCTGA
TCTAGTTGGAGACAGAGATAGACATGCATGGAAGAACAAAGAAGCATAGGCCATTTTGGA
GTGCAATCGACTGCATTCCTCCCAAGAAATACATTCTGAGTTTCTATAGAGCAGATGCCT
GAGTTCACAATAATAGATGAATAAGATATTAATTAATAGACACCTATATTTCTCATACTT
ATTTTCATACAAGATGATTCAGGTAAGGAATCAAAGGGGAGATAAAGAAATAAAGTGGAG
GAAGGCAAAGAGAAATCTGACTAGTTTACAATCTTGTCTACAGCAGCAGAGATGTTGTGA
AAAAAAAGATGTTACAACCACTAAGTTTGGAAAATGTAGCATTGAGAGACTTGCACCATA
CATCAGCAAAATAAAGGTTCTGAGAAGTCCTGCAGATTAAATAAACAGAACTGTTTCCTC
ATGTGAAGTCTATTTACATTCTCACAGAATGTAAATTTGACTGGGGCCAGTCAGATTAAA
AAAACTTTTATTAAGGCAGCGTCCCCAACCTTTTTGGTACCAGGGACCAGTTTCGTGGAA
GACAATTTTTCCACGGAGTGGGGGTGGGGGAAAGGTTTTGGGATGAAACTGTTCCACCTC
GGGTCATCAGGCATTAGATTTTCATAAGAATCAGGCAACCTAGATCCCTCGCATGTGCAG
TTCACAATAGGGTTCCTGCTTCTATGAAAATCTAATGCCCAGCTGATCTGACAGGAAGTG
GAGCTGAGGCGGTAATGCTGGCTTGCCCCCTGTTTCTGTGGGGCTTACTGTGTGGACTGT
TTCCTCGGGTTGGGGACCCCTGCATTAAGAAATGTAAAATGAAGATTATATTTTCAGGGA
TCATTTCTATAGTTTGTCACTAGGGAAGTTCCTCTGAATGTGTAGAGCACCAGAAACATG
AGGAAGAGGCACAGGGTTCTCTCCTGAGTGTGAAGCTGGCTCTTGGCGCTGCTTTCCTGC
AACTGCTATTTGCCATTCGTGATTGTGGAGAGTCAGAGGGAGAGGATGATGCAGTCTGAG
TGGTTTCCGCTATAGAAAGAAACAGAGAAAGGCAGGAAGGGAGGGAGGAAGAAGGGAGGG
AGGGAAGGAAGGAAGGAGGGAGGGAGGGAAGGAAGGAAGCAGGGAGTAAGGGAAGGAAGG
AGGGAAGGAGGAAAGAAAGGAGGGAGGAAGGAAAGGAAGAAGGGAGGAAAGAAAGGAAGA
AGGGAGGTAGGGAAGTAAGAAGTGGGGAGGGAGGAAGAAGGGAGGAAGGAAGGGAGGAAG
GAAGGAAAAGGGGGGGCAAGGAAGGAAGGAAGGAAAGAAGGAAGGGAGGGAGGGAGGAGG
GAAAGAAGAAAAGAAGGGAGGAAGGAAGGAAGAGAGGGAGGGAGGGAGTAGGGAAAGAAG
GAGGGAAGGAAGGGAGGGAGGAAGGGAGAAAAGCAGGAGGGAAGGGAGGGAGGAGGGAAG
GAATGAAGGAAGAGAGGGAGGAAGGAAGGAAGGAGAGAAGGAGGGAAGGAGGGAGGGAGA
GAGGGAGAGAGGGGAAACAAAAGAAAAGAAAAGAAAAAAGAGAGGGACGTAAGGATTGAA
TTTTCTCCTAACATCAACCATGTCTCTGAGCTCTAGATCAGGAGAATCCAGATCTCTTCA
CTGTGTTTGTGTAAATTCGCCACCTGGTACCTCCCAATTTTCAGGGCAAATGTCCTCCGC
CCATGATAAATGGTAATCAATACATCAAGAAACGTTCTGAGTAAGTTAATTATGACACCT
TTTTCACAAACTCAGGTTAGTTTCCAACTTATTGTCAACTTAAATAGGTTTCAGTAGGAA
AGCTATTAACTTCTGTTGACTGAGAAGAAATAGAATTATTATCTTGTTTATCAAAAGAGC
CAATTTGTCTGTCTCCCTAAATGTATTTATTAAAGTAAAAAGGTTGCTTTTTATTGCTGT
CATTGGAAGATTGTGGCTTATTATCATTCCAGTTGTTTTTTCGGATACAAAAGAGTTCAG
AATACTGTTGCTATCTACACCTTCCTTGAGTGTTCTGAGGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved