Homo_sapiens Locus Mono:153:AL138702.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:153:AL138702.8
Homo_sapiens
Mono:153:AL138702.8
13
SNORD116-9L1
1001..1087
2087
CCATTCTTGAGTTCTCTAAGTAGACAGTTTCATCTATCATAAAAAGAAATCTTACTTTT
CTATATTTGCCTCTTTTATTTTTTCCTTTCTCTATACTTTCTCTATTTCTGCTACACATC
CCACTAAGATAAGTAACAAGGTAGCCTGGACCCCTCAGTCTTGTCACTTTCAACTTTTCT
ACTAAATGTAATGGTAACTCTTGGGCTAAGTATATAGTGTTTATGGTGGCCATTAATAAA
TTTGTCTTTAATACACTTTTAGAGTTTTACTGATGAATGGATTCTGAGTGTTATTGGATT
TCTTCTCATTATCTTTTAAGCTAGTGATATGCACTGTTTTATGTTACTGGCTACTGTGAG
GAAGTAGCCAAGATCTACTATGTATTTTGCTGCAATGAAAATAATAGTATGTACTCTCCA
GATTACTGTGAAGTTGGGAGAAAACTGACAAGCAGATCACCTGAAAGTGCTGGTTACGTG
GTAGATGCCGGTGAAAGATTCCCATTGCCTTTCTTGGATTTCGCTTAGCTCTAGAGAACT
GTGTCAGCTCCTCCCCATGCATCTGGGCACATTCTGTCCCCAGGTCCTGCCCCTGCTTAG
GTATTGTCTTTGCATTTCCATTTCCTGGTTTGGCATATCTCTGGGTCCTGGGGTTCCTCA
TCTTCCTTCATCCCTGGCTCAGAGTTGGCTTCTTTTCAGACTGTGGCTCTGGCTCTGGCT
CTGGCTCTGGCCGTGCTGGGACTTAGCTCCTCCTCTGCTTACATACAGGCCCTTCCCCCA
ACCCCACTCCCACACTACCTTCCTGCCCCCAGCCATGGATCTCCCTAGAACTCTCCACCG
CCACACCTCTGTGCTGCTGCCACTTGACATCAGACACCAAGAGTGGCTTCTTGCCAGACA
TGCCTACTGGGTTTAAACCCTCGGGTTTGACAATAAAAAAGAGAGAGGAATTGTTTACAA
CAAGAAGTTAGGCCAAAAAATGAATTTTAGAAATTAATTTGAGATTGATGATGGCACCCC
CATAAAACCATTCCTTAGGAAATCTGAACAAAATGAGTGAAAACTCACTAGTTGTTCTCA
TTGAGGCTGGGCCCCAGGATTCTGACCTTGATTCAGGATCAGGGGATCGTGATCTTGATT
CAGGATCAGGAAATTCACTTCTGTGGGGGTGCCCTGGTCCGTCCTGACTTCCAGCTGACT
GTGGGCCAGCTGCTTCCACAGCAGGAGAAATGTCCTCCGTGATGCTGGGGGCCCACGACC
TGAGGTGGGGGGAGAGATTCCAGCAGATGTGTTCCATACGGACCATCCGTGAGAATGGCT
GACCCCCACCTGGATGACTTGCTGCTGCAGCTGGACTGTGAAGCTGACCTCCCCAGCGGT
GTGGTGCTGGGGTCGCTGCACCTGCAGAATGCCACAGTGGGAGCATGCACCAGCTGCCAG
GTGGCTGCTAGGGGGACCCAACAGAGAGGGAGGCACCTCTCATGCTTCCCAGGGGTTGTC
AATGTGAGGGTGACCCCCGAGGTGGAAAAATTCATTAAAAATGAATGATTTCTCAAAACC
ACTACAGGCAACTCCCAGGTACAAAGCCTAATTGAATGCCACTTTTTAAGAACCAATTTA
GCCCTGAGTTAGAGGTGGTGGAAATCTTCATTCTACTTGCAAATCAGCTGCGGTGCTTTA
GCCAACTTCTGCAGTGTTCTACGTTCTATTAAAGCTTACACTGAAAATGCTTAGTTAACA
AACGCACTTTATCAATACAATAAAGTGTTCACCTACTATTTTTAGGCAACAGCTAGGCAA
CCCACTGTGTTTCCTTCATCATTTTAGCTACTGAGCTGTTAGAAGTCTGTATTATAGTAA
AAAAACAAACAAAACAAAACAAAAAAACTTATTTTTTACTCAGGTTTCTGATATAACCAT
TTTATATCCCTCCTCTTTTACCTTCTTGGTCTTGTCATTTTATTCTTGCATTATTATGTA
AAAACAAACAATCTTGTCATTTTATTCTTGCATTATTATGTAAAAACAAACAATGACTTG
GGGTCTTCATTGTGTTGCTTTTGTAGATACTGTTTTTAAAAAGAAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved