Homo_sapiens Locus Mono:298:AP003113.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:298:AP003113.1
Homo_sapiens
Mono:298:AP003113.1
8
SNORD3@L25
1001..1213
2213
CATGGCGGCAGGAGAGAGCACATGTGAAGGAGGAACTGTCAAACACTCACAAAAACATC
AGATCTCATGAGAATTCCCTCACTATCACGAGAATAGCATGGGGGAAACGACCCCATGAT
TCAATTACCTCCCACTAGGTCCCTCCCTCGACACATGGGGATTATGGGGAATACAATTCA
AAATGAGATTTGTGTGGGGACACAGGGCTGAACCATATGACTACACTCTAAGTGGGAGTG
TGAGGCAGGCTGTGCTGCTGTGCCTTAAAGAACTGTGTGGTCACTGAACTTTGGATCCTA
CACTCCATCAGTAACCATTTTACACATACATATATATAGTAGATTATAAGTATCAGTTAC
TGTACAGTATTTTATAAGCAATACAAAACATCCATTAAAATAAAGATTGGGAGGAATGAA
ATATAAAATGAATATAGAGAGAAGTTCTCTGGAAGTTCTATTTTCTTCCCACATTTCTTC
GTATCATCCTGCACACTCCTCTTTGGAGAACACTGTCTTAATGTAAGAAGCTGGGCCTTC
TCTAAACCACCTCTTGGCACTTCCAGCAAGCTTTTCATCATCCAACCCCAACCCATCTCC
CCAGCTGTCCCTGCTGGTGCTCTCCACCCATACTCCACTATCCACCATGACAGCATACAC
ACCATTTCCTGCATGCACAATGTACTCTGCATTTTTTTGTTCATGTCATTCCTTCATCCC
AAATGCCTCTCCCTCTTTCTCCAGCTATCAAAATTTTCAGCTTGCAAGACCCAGTTCAAA
TTCTATCTCTACCCTGTAATTAACCTAGATCCCTTCTCAAATAGAATGAATCACTTTCTT
CCATAATATTAACTAAAATTATATTTTCTAATCTTCCCAATATCCCTGCAAAGTATTATT
GAGTATTTGACAGATCAGAAAAGGCTCTTTTCTAGTCAGAAAGACTATAGAAGGCTCTTT
TTCTAGTCAGAAAGACTATAAATGGCTCTTTTCTAGTCAGAAAGACTATACTCTCAGGAA
TCATTTCTATAGTTTTTTACTAGAGAAATTTCTCTGAACGTGTAGAGCACTGGAAACCGT
GAGGAGAAGCTGCCTTCTCTTCTGAGCATGAAGTGAGCTCTCAGTGTTGCTTCTCTGCAA
CTGCCATTTGCCATTGATGATCGTTCTTCTCTTCCTCTGGGAGAGTAAAAGGGTACAGGA
TGCAGTCTGAGTAATTACTGCTTTAAAAAAGAAAAAGAAAAGTCTCTTGGATATTGTGTA
ATTAACCCATACCCCTAGTGACTGACAGGAGCAGAATTTGAACTCATAACACCCCGGTGG
CTATGTTCTTTCCAGTGCACTAAGGTTTCCTTCATGCCTTGGCTTCCCATGACAGAAACT
GCACTCTATATATATTCTCTTATGACATCTTCAAGTAGCCCTGTGAATACATATTATCAT
CTCTAGATTGGAGCTGAAAAAACAAAGCCTTGGAAAGGTGAGGTAGCTTGCCTAACGTCA
CTTAGTTAGCAAACAGCAGGGATGGTTCCAACCCAGGTTAGTCTGACTGTAGATCCCATA
TTCTTTCTGTTTTGCCATGCAAGTGGGTCTATTCTTCTCATTACTTGTTACTTTCACCTC
ACTTTAGCTTTTAGTCATTTTGCCTTGGCTTAAATAGCAACTTTAATACCTCTTTCCTTC
AATGCTCTGTGAGGTAACTGAGGACAAGAAAATATGTTTCACTCAAGTCTCTGGTGGCCA
GAAACTACATATCAAAAGTATGTTTATAAATGTGAAGTTGAACCCTATAGGAAGAATGAT
TGCAAAGAAATCTCAATTCACTGTGCTGTCTCTGTCTCTAGAGTTTTTGTACCTATTGGC
TTGCCAACACTGCATTCAAAGAATATGGAAAGGAAACTGAAAACGGTGGAAGAGACCACC
ACCTCTTGCTATCTCCTAAAAGATCATTTTTAATAAACTGCAGCCTACCCTTGAAAACTG
TCTATCATAAGCAGAGTGCTGGCAACATCTCCTGAAAGATGATAGAGGTCCAGGTGGCCA
TCCAGATGCTGGAACATGCCTGAGGACGTGGGGGGATGTTTAAAATAATTGATAATTTTG
AAAACAGAAAACAGTTTATTATACAAGGATATAAAGAATAAAATATTTTGTATAGCTGTA
CAGTGTGTTTGTATTTTGAGCTAAGTATTATTACAAAAGGGTCAAAAAGTTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved