Homo_sapiens Locus Mono:14:AC063965.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:14:AC063965.8
Homo_sapiens
Mono:14:AC063965.8
10
SNORD74L3
1001..1078
2078
CAGAAACACAAATTCCAACTTTAATGAATGCTAGAGACATTTGTAGCCAACAAAAATAT
GAAGATGAAAAGAGGTGGAAGGATAGTAACTACCTATAGGAACAGTAGAAAGTGAAACAA
GTGCTTGCAGAGAGATACTGATGAGAAGAAAGTTGATTGACTCTGCCTAACCCTGAAAAG
ACACAGAAAATGGAGTTATCCAGTACTATAAAAAAGGGAGAAAAATGGAAAATTGAGCCT
TGGGATTTTGGATCTCTTGCGCCACAATATGAATGGACAACCAAGTATTTCCAGACATTT
ACAGTAATATAAAAATAGAGATTCAAACAAACTGTAAAAAGGAACTTGAAGAGGAAAAAA
AGTATAAAAGCTGAAGAACTCTTGAAATTTAAAACACTGTAATTACTCCTCTCAGAATGA
TAAGAATATATTGTGTGTATAAATCAGCAACAGGAAGCCACATAAAAGAAAAGTTCGGCC
AGGCACAGAGGCTCACACCTGTAATCCCAACAAGCGTTGGGAGGCGAGGCAGACAGATCA
TGAGGTCAAGAGATTGAGACCATCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAA
ATACAAAAATAAGCTGGGCATGGTGGTGCACACCTGTAGTCCCAGCTGCTCGGAAGGCTG
AAGCAGGAGAATCGCTCAAACCCGGGAGGCAGAGGTTGCAGTGAGTCGAGATCACACCAC
TGCACTCCATCCTAGCAACAGAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAGAAAAAGA
AAAAGAAAAAAAAAGACAGAAAAATTCAGAGAACAAGAAAGAGATCTTGGAAATAAAAAT
ACAACTGCAATGACTTTTTAAAAATCAATAGAGCAATTGGAAGATACAAACCAAGAAAAT
CCCTCACTTTTCTTTGAAATTAAGGACTTGTTAATAATAATACAGAAAACTTCCTCCCAG
AATTTAGAAAAAAAAGAGAAAGCTTTTTGCAATCAAATTATCAGTCCAGCCTCTGATGAA
GCCTATGTTAGTAGGCACATCTGAGTGGTAATGAATGCCAGCAGCTCTGATGAAAAAAAC
AGGATCAATCCAGAAGATGAGTTCCAGAAAGGAAGAAGAACAGAGAAAATAATGGGAGGG
AAATTATTTTATATACACACACTTAATTCCCAGAATTAAAAGACATAAAACTATAAATTA
AAAGGATCCACAATTACACACAATGAATATTAAAAGATCCCTAGGACACATTATCATAAA
ATTTTAGAACATCAAAAATGAAAAGAAGATCCTAAAAGCTTCCAGACAGAAAAACAGGTC
CCATAGAAATGACAGAAATCCAAATGGTATTTGGCTTTACAACAGCTATATCAGAGGTGG
CAGCATAGGGGAAAGGTTGGAAACCTGGCTGCTGGGTTTGAATCCTGACTCTATACTCTG
TGAGTAATGATAGTGTTGTTATGAGGATAAGGTAGGTTCGTATTTATAAGCGTGCAGAAC
AGTGTCTGGTACCTAATATTTGCGATTTAAGTATTTTCTAAATATACCTAGGGAAGATAA
ATTGAACACGTATTCTAAATTCTGAGGGTAAATGAGTAAATGAGCTGCCACTTGCAAGTC
AGTACCTAACTAAAACTCTTAAATAGGTATAAGAATAGAAAAAAACATCTTTTTTTTTTT
TTAGGCAGAGTCTCTTTCACCCAGGCTAGAGTGCAGTGGTGCGATCTCGGCTCACTGCAA
CCTCCACCTCCCAGGATTAAGCAATTCTCATGCCTCAGCCTTCCTAGTAACTGGGATTAC
AGGTGCTCGCCTGTAATTAGCACCAGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTTC
GCCATGTTGGCCATGCTGGTCTTGAACTCCTGACCTCAGGTGATCCACCCACCTTGGCCT
CCCAAAGTGCTGGGATTACAGGAATTAGAAAAAAAAAAAAAAAAAAAAAACATATTTTCA
GGCATGCAAAGTCACCCCCAAAATTAACTTCCTCTGCACCTTTTCTCAGGAAGCTCCAGA
ATTATAAGCATCACTGAAAATAGGGATTAAACTAAGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved