Homo_sapiens Locus Mono:72:AC012435.13
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:72:AC012435.13
Homo_sapiens
Mono:72:AC012435.13
15
SNORD77L4
1001..1070
2070
AGAGTCACCACCCCTACTTTCCTATGGAAACTCTCCTCATGCTTGGGCTCCAGCACCCC
ATTCTTACCACCACCAGTCCCCCTCTCCACACCACGGACTCCCTCTTCATTCAATCTGGG
CTTTCATACTCTCAGCCCAGTTGTGAAATGGGACTTTTTACAACCAAAAGATTAAGAATG
TACACTATAAATTGTGACTTTGATGAAATCAGTAATATTTCTTCATATAGGCCTGAGGAC
CAAATTAACTATATTCTGAACTTAGTTGGGGTTCTAAAAGGACCTGCTGGCCATGCATGG
TGGGTCACACCTGTAGTCCCAGCACTTTGGAAGATTGAGGTGGGTGGATCACTTGAGCCC
AGGAGTTCGAGACCAGCCTGGGACAACATAGCAAAACCCTGTCTCTATAGAAAATACAAA
AAATTAGCCAGGCGTGGTGGCACATACCTGTCCCAACTACTTGGAAGCCTGAGGTAGGAA
GATCGCTTGAGCCAGGGAGGTTGAGGCTGCAGTGAAGCGTGATTGTGCCACTGTACTCCA
GGCCAGGTGACAGAGTAAGACCCTGCCTCAAAAATATAAATATAAATATAAATAAATGAA
TAAATAAAAGTACCTGCTATGTTTTAGTATTTAATCTACTTGGAACTTGTTTTTGTATGA
TATAAAATGGAGGTCCAATTATTTTCCTGACAGATATCATCATTTATTATATAATCCATC
CATATCCCACTGAATTAAAATTGCACTGTTCACATTTTATGTTCTTAAAAACAGATATCT
ATTCCTGGATTCTCTTTTCTATTCCACTGGTTTATTTGTCTATGCCCAGGCCAATATTAT
ATTGATGCTATTGTGGTATCTTTATAGTGTCTTCTGAGATCTAGTAAGCCAAGTGCACCC
TTACTGTACTTCTTTCTACATTTATTGGCTATTTACAAGTACTTTATTCTTTCCAAATAA
ATCATCAGATAATTTAATCCAATTAAAAAGAAACCTGTTGGATACTGTGACAGTTGCATC
GTTCAGCAGATTGAGTCACGAAGAGATGTATACCATCTGTCTGATGTATCTGGGGTGGTT
GGGAAAAAAAAAACTGTTGGGATTATACTGGAATTTTTTTCTTTTTTTTTCTTTGCCCCA
GCTGCTGGGATATAATAGGAATTTTATGAATTTTATATATATTTGTAGAGTTGTCCTTTT
TGTGATAGTGTCTTAATATTCAAGAAAGAAACAATGAAGGTCATACAATGCCTGCTCATT
ATTCAGATCTTGATTCATTTATTTCCCCAACATATATATTTGAGCACCTACTATAGGCTA
GACACTGTTCTAGATCCTGGGGATTCAACTGGGAACAAAACAAAGTTTCTGCTTTTTCAA
AAAAGCAGAAAGTTTAGTAGTAGGAGATAGGTAATAAATATAAATACACACACACATATA
TATATGTAAATACATATGTAATACGTCAGATGGTATTAAATACTATGGCAAAAAATGAAT
CCAGCTAAAGGGGATATAGTGTGCTGGGAGGAGGGCTGTTTTTTAATTTAGTGCAAAAGA
TGATGTGGTGATATTTGACACATATATGAAGGACATGAAGGAGTCATCTGTGCATTCCAG
GTGGGGGAGACAGCAAATGCAGAGGTGGGAGTGTGCTTGGTGGGTTATGCTGGCAGAGGA
AGAGCAGGCAGCCCGGTGTGGCTACAGCAGGGTGAGCAGCCGGAAGAGGGGCAGGAAGTG
GAGACAGAAAGGTTGCTGGGAGGCGCCATACCGAGTACAGCCATGGAGACCACTGTGAGT
ACTGTGGCTAAATAACTCAGGGAGAAGGGAAATTACCCTGAATTTTGAGCAGAGGAGTGA
CATGATCTGATGATCTTAACAAATCATTCTGGTGGACAGGAGTGGAAGCAGGGAGACCAG
TTAGGACTCTGGCTTTGTCTTGCCTGAGATGGGGGTGGCTGGGAGGAGGGTGGGGGTGTG
GGGGGTGAGAGATGGGGGATTCTGATTTGGCTGGCTTGCGTGCCATTGCAGGCCACCAGA
GGGCACTACACATACGTCCTTGGTGAGGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved