Homo_sapiens Locus Mono:263:AC106017.11
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:263:AC106017.11
Homo_sapiens
Mono:263:AC106017.11
17
SNORD3@
1001..1216
2216
TCATTGCACTCCAGCCTGAAAAAGGAGTGAAATTCTGCAACATGTTACAACGTGAATGA
ACCTTGAAAACGTCATTCTAAGTGAAATAAGCCAGATACAAAAGGACAATATTGCATGTT
TCCACTTATAGAGATACCTACAAGAATCAAATTCATAGAGACGGAAAGTAGAATAGTGGT
TAAAGGGGTCTGGGCGGAGGGAGGAAAGGGAAGTTTGTTTTACGGGTAGAGTTTCAGTTT
GGGATGTCGAAAAAGTTCTGGAGATAAATAATGGTGATGGTTACATGCCAATGGCTACAC
GAATGTACTTAATGCCACTGAATTGTATATGTGAAAAATGGTTAAAATGGTAAATTTTGT
ATCTATTTAATACCATCCCCCCTAAAAAAAAAATTGTTTTTAAGAGTCAAGATCTCACTC
TGTCTCCCAGGCTGGGGTGCAGTGGGGTAACTGATCAGAGCTCACTGCAGCTTTGAACTC
AGCCAGCTTCCCTGACTCAAACGATCATCCCGCTTCAGCCTCCCGAGTAGCTGGGACTAC
AGACGGTGCCATCACGCCCAGCTCATTGTTGATTCCCGCCCCCTTGGTAGAGACGGGATT
CCGCTATATTGCCTGGGCTGGTGTCGAACTCATAGAACAAAGGATCCTCCCTCCTGGGCC
TGGGCGTGGGCTCGCAAAACGCTGGGATTCCCGGATTACAGGCGGGCGCACCACACCAGG
AGCAAACACTTCCGGTTTTAAAAATTCAGTTTGTGATTGGCTGTCATTCAGTATTATGCT
AATTAAGCATGCCCGGTTTTAAACCTCTTAAAACAACTTTTAAAATTACCTTTCCACCTA
AAACGTTAAAATTTGTCAAGTGATAATATTCGACAAGCTGTTATTGCCAAACTATTTTCC
TATTTGTTTCCTAATGGCATCGGAACTAGCGAAAGTTTCTCGCCATCAGTTAAAAGTTTG
CGGCAGATGTAGACCTAGCAGAGGTGTGCAAGGAGGCCGTTAAGACTATACTTTCAGGGA
TCATTTCTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGAAAACCAC
GAGGAAGAGAGGTAGCGTTTTCTCCTGAACGTGAAGCCGGCTTTCTGGCGTTGCTTGGCT
GCAACTGCCGTCAGCCATTGATGATCGTTCTTCTCTCCGTATTGGGGAGTGAGAGGGAGA
GAACGCGGTCTGAGTGGTTTTTCCTTCTTGATGGCTCAATGACAGAGACTAGCTCGTAAA
CTCCGGGGCGTTTCTGGGCTGTTCGCTCCTGCTTGGCATGTCGCGAGAAAGGTTTTCGCC
TCCTGTTTCAGCGGTGACGGCTCTTGGGTTTTCTCGGGGTGGCTTTTTAATTTTAGTCTT
GGCGCGAGGCGGGGGATGCTGTGTGGCACCTCCTATTGTCTCTTTTTGCGTTTTCTCCCA
TTCTCGCTCCCTCTTTTGTCGCCGTTTCCCGCCCGCCACTCCCACCCCCAGACGGGGTCT
CCGGGTCTCTTGTTCTGTCTGCCGGCCCCGGCTGGATTGCAGTGGCGCGATCTCGGCTCC
TAGCAACATCTGCCTCCCGGGCTCAAGCGAGTCTCCCGCCTAAGCCCTCCCGAGTAGCCG
GGGCTTAAAGGCGCACACGCCACTCCAGGCTTTTTTTTTTTTTTTTTTTTTTTTTTTGGC
AGAAACGGGGTGTCAGCATGTTAGCCAGGCTGGTCTCCAACGCGTGATCTCAGGTGATCC
GCCGGCCTCGGCCTCCCGAAGTTCTGGGATTACAGGCGTGAGCCACTGCACCCGGCCCTT
CTATTTTTTTAAATAGCGACGGGGTTTCACCATGTTGGCCAGGCTGCTCCTGAACACCTG
AGTTCAGGTGATCCGCCCGCCTCGGCCTCCCGAAGTTCTGCGATTACAGGCGTGCCACCC
GCACCCGGCCCTAAAAGTACTTTTTATAGAGATGGGGTCTCACTCTGTTGCCCAGACTGG
TCTCAAACTGCTTATCTCAAGTGACTGACTGTCTGCCTCAGCTGCCCAAGTAGCAGGGAT
TACAGACACAAGCCACAGCCGCTGGCTCTATTCAGGAACATCTTAGTTCCAAGTTTTGGC
AATTATGGATAAAGCTGCTATAAACAGGTGTGCAGGTTTTTGTGTGGACATTTTCAACTC
ATTTGGGTAGACACCAAGAGGCACGAGTTCTGATCATACCGAAAGTGTTTAGTTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved